ID: 1114647521

View in Genome Browser
Species Human (GRCh38)
Location 14:24263845-24263867
Sequence CGCTGTAGCCTCGGGGGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114647521 Original CRISPR CGCTGTAGCCTCGGGGGTTA GGG Intronic
900086588 1:901138-901160 CGCTGGAGCCTCGGAGGTCGAGG + Intergenic
904014928 1:27412288-27412310 CGCTTGAGCCTGGGAGGTTAAGG - Intronic
904710744 1:32427833-32427855 CGCTGTAGCTTCTAGGGTAAAGG - Intergenic
906222006 1:44088200-44088222 CGCTAGAGCCTGGGAGGTTAAGG - Intergenic
908396515 1:63730252-63730274 CATTTTAGCCTGGGGGGTTATGG - Intergenic
908932853 1:69338544-69338566 CGCTTCAGCCTGGGAGGTTAAGG + Intergenic
910504670 1:87936198-87936220 CTCTGTAGCCTGGAGGGATAGGG + Intergenic
911058277 1:93726146-93726168 CGCTGGAGCCTAGGAGGTTAAGG - Intronic
915560219 1:156682755-156682777 CGCTTGAGCCTGGGAGGTTAAGG - Intergenic
916198586 1:162248605-162248627 CCCTTTAGCCTCAGGGGTTATGG + Intronic
920023310 1:202972386-202972408 CGCTGGAGCCTGGGAGGTTGAGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922711405 1:227836180-227836202 CGCTGGAGCCTAGGAGGTTGAGG - Intronic
923344167 1:233034956-233034978 CCCTGAAGCCTCTGGGATTAAGG + Intronic
924251803 1:242140551-242140573 CGCTTTAGCCCAGGGGGTTGAGG + Intronic
1068149942 10:53118902-53118924 CCCTGAAGGCTCGGAGGTTAAGG - Intergenic
1068772497 10:60837548-60837570 CGCTGGAGCCTGGGAGGTCAAGG + Intergenic
1071109939 10:82143944-82143966 CGCTGGAGCCTGGGAGGTCAAGG + Intronic
1073222794 10:101890325-101890347 CGCTTGAGCCTGGGAGGTTAAGG - Intronic
1073474178 10:103742063-103742085 CGCTTGAGCCTGGGGGGTTGAGG + Intronic
1074590568 10:114808998-114809020 CCCTGGAGCCTTGGGGCTTAGGG + Intergenic
1074773751 10:116750887-116750909 CGCTTTAGCCTCGGAGGTCGAGG + Intergenic
1074785912 10:116839828-116839850 GTCTGTACCCTCTGGGGTTAAGG - Intergenic
1076754056 10:132558867-132558889 CGCTGCAGCCTCCGGGGCCATGG + Intronic
1076896673 10:133316636-133316658 CGCTGTGTCCTGGGGGGGTATGG - Intronic
1078158150 11:8816465-8816487 CGCTTGAGCCTGGGAGGTTAAGG + Intronic
1078262099 11:9719289-9719311 CGCTTTAGCCTGGGAGGTCAAGG + Intronic
1089277380 11:117346778-117346800 CGCTTTAGCCTGGGAGGTTGAGG + Intronic
1092346147 12:7716017-7716039 CACTTGAGCCTGGGGGGTTAAGG + Intronic
1093059462 12:14588202-14588224 CGCTGGAGCCTGGGAGGTTGAGG - Intergenic
1101364303 12:104057435-104057457 CGCTTTAGCCTGGGAGGTCAAGG + Intronic
1104004167 12:124880492-124880514 CGCTTGAGCCCCGGAGGTTAAGG + Intronic
1106634767 13:31516514-31516536 CGCTTGAGCCTCGGAGGTTGAGG - Intergenic
1109212211 13:59547756-59547778 GGCTTTAGCCTCAGGGATTAAGG - Intergenic
1114647521 14:24263845-24263867 CGCTGTAGCCTCGGGGGTTAGGG + Intronic
1118337601 14:64867417-64867439 CGCTGTAGCCTGGCTGGTCATGG - Intronic
1121258219 14:92547476-92547498 CGCTTGAGCCTAGGAGGTTAAGG - Intronic
1122369022 14:101217652-101217674 TACTGTAGCCTCTGGGTTTAGGG + Intergenic
1123468999 15:20536313-20536335 AGCTGCAGCCCCGGGGGTTGTGG - Intronic
1123649059 15:22464378-22464400 AGCTGCAGCCCCGGGGGTTGTGG + Intronic
1123729275 15:23131301-23131323 AGCTGCAGCCCCGGGGGTTGTGG - Intronic
1123747443 15:23328783-23328805 AGCTGCAGCCCCGGGGGTTGTGG - Intergenic
1124279804 15:28352635-28352657 AGCTGCAGCCCCGGGGGTTGTGG - Intergenic
1124302894 15:28558969-28558991 AGCTGCAGCCCCGGGGGTTGTGG + Intergenic
1124531991 15:30516619-30516641 AGCTGCAGCCCCGGGGGTTGTGG + Intergenic
1124766662 15:32491026-32491048 AGCTGCAGCCCCGGGGGTTGTGG - Intergenic
1126448053 15:48772325-48772347 CGCTTTAGCCTGGGAGGTTGAGG + Intronic
1127247080 15:57188869-57188891 CGCTGGCGCCTGGGAGGTTAAGG - Intronic
1127565772 15:60186841-60186863 GCCTGTAGCCTAGGGGATTAGGG - Intergenic
1131185758 15:90272590-90272612 CGCTTGAGCCTCGGAGGTTGAGG + Exonic
1131920800 15:97326593-97326615 GGCTGTGGGCTGGGGGGTTAGGG - Intergenic
1132170839 15:99652439-99652461 GTCTGTGGCCCCGGGGGTTAGGG + Intronic
1133472973 16:6093703-6093725 CGCTTGAGCCTAGGAGGTTAAGG - Intronic
1134817947 16:17221653-17221675 CGCTTGAGCCTGGGAGGTTAAGG + Intronic
1138049978 16:53766307-53766329 CGCTGAAGCCTGGGAGGTCAAGG - Intronic
1142238196 16:88932561-88932583 CGCTTGAGCCTAGGAGGTTAAGG + Intronic
1143162689 17:4881687-4881709 CTCTGTAGCATCTGGGGTTCTGG - Intronic
1143483264 17:7238986-7239008 ACCCGGAGCCTCGGGGGTTAGGG - Intronic
1146341046 17:32020392-32020414 CGCTGTAACTTCGAGGGTAATGG + Intronic
1147180965 17:38685524-38685546 GGCTGTAGCCTCTGGGGTCAAGG - Intergenic
1155932585 18:31723473-31723495 CGCTGTAGCTTCTAGGGTAAAGG + Intergenic
1161696587 19:5772129-5772151 CGCTTGAGCCTGGGAGGTTAAGG - Intronic
1161753417 19:6114052-6114074 AGTTGTAGCCTCGGGGAGTAAGG + Intronic
1163830917 19:19546842-19546864 TGCTGTAGCCCCGGGGCATACGG - Intergenic
1164837745 19:31368694-31368716 CACTTGAGCCTGGGGGGTTAAGG + Intergenic
1164939986 19:32244640-32244662 CACTTGAGCCTAGGGGGTTAAGG + Intergenic
1165192192 19:34074294-34074316 CCCCGAAGGCTCGGGGGTTAGGG - Intergenic
1165274237 19:34734242-34734264 CGCTGTAGCCTCAGGCCTGACGG + Intronic
1165743012 19:38214748-38214770 CGCTGGAGCCTGGGAGGTCAAGG - Intronic
1166375136 19:42323788-42323810 CGCTGGGGCCGCGGGGCTTACGG - Exonic
1167293666 19:48637467-48637489 CGCTGTGGCGTCGGGTGTTTTGG - Intergenic
1167322102 19:48803442-48803464 CGCTGGAGCCTGGGAGGTCAAGG + Intronic
1167490546 19:49790480-49790502 CGCTTTAGCCTGGGAGGTGAAGG - Intronic
925167630 2:1728017-1728039 TGCTTGAGCCTCGGAGGTTAAGG - Intronic
927987622 2:27424148-27424170 CGCTTTAGCCTAGGAGGTCAAGG - Intergenic
931258805 2:60598908-60598930 CGCTTGAGCCTCGGAGGTTGGGG - Intergenic
932303074 2:70681483-70681505 CACTGAAGCCTCAGAGGTTAGGG - Intronic
932303369 2:70684329-70684351 AGCTGAAGCCTGGGAGGTTAAGG - Intronic
936141477 2:109945796-109945818 CGCTGTTGCCTCGAGGATGAAGG - Intergenic
936178166 2:110243744-110243766 CGCTGTTGCCTCGAGGATGAAGG - Intergenic
936471265 2:112800781-112800803 CGCTTGAGCCTCGGAGGTCAAGG - Intergenic
938848011 2:135231702-135231724 TGCTGGAGCCTCGGAGGTTGAGG + Intronic
942470763 2:176257513-176257535 CGCTTGAGCCTCGGGGTTTGAGG - Intergenic
946277262 2:218641016-218641038 CGCTTTAGCCCAGGAGGTTAAGG - Intronic
947121881 2:226823984-226824006 CGCTGTTGCATTGGGGATTAAGG + Intergenic
948987996 2:241537297-241537319 CGCTTGAGCCTAGGGGGTCAAGG - Intergenic
1172174522 20:32964139-32964161 CGCTGGAGCCTGGGGAGTTGAGG - Intergenic
1174216559 20:48920980-48921002 CGCTTGAGCCTCGGAGGTTGAGG - Intergenic
1174546194 20:51327108-51327130 CGCTGGAGCCTGGGAGGTCAAGG - Intergenic
1176144198 20:63558308-63558330 CGCAGTGGGCTCGGGGGTTGGGG - Intronic
1177081861 21:16649629-16649651 CTCTGTAGCCAGAGGGGTTAAGG - Intergenic
1178238823 21:30875584-30875606 CGCTTTAGCCTGGGAGGTTGAGG + Intergenic
1178298795 21:31433879-31433901 CGCTGGAGCCTGGGAGGTGAAGG - Intronic
1181123093 22:20685539-20685561 CGCTTGAGCCTCGGAGGTCAAGG + Intergenic
1182206548 22:28633542-28633564 CGCTTGAGCCTAGGGGGTCAGGG + Intronic
952370720 3:32720574-32720596 CGCTGGAGCCTAGGAGGTTGAGG - Intronic
952934314 3:38383707-38383729 CGCTGGAGCCTGGGAGGTCAAGG + Intronic
954144232 3:48626449-48626471 AGCTGTAGCCTCAGGGGTGGAGG - Intronic
956892262 3:73624473-73624495 CGCTGTCGCCACGCGGGTTGCGG - Exonic
961113489 3:124306156-124306178 CGCTTGAGCCTAGGAGGTTAAGG - Intronic
961233150 3:125338574-125338596 CGCTTTAGCCTGGGGGGCAAAGG + Intronic
961502821 3:127349976-127349998 CGCAGCAGCCTCGGGGGATGCGG - Intergenic
963220084 3:142799714-142799736 TGCTGAAGCCTAGGAGGTTAAGG + Intronic
964469684 3:157039533-157039555 TGCTTGAGCCTCGGGGGTTGAGG + Intronic
967412959 3:189185305-189185327 CGCTTGAGCCTGGGAGGTTAAGG - Intronic
967564203 3:190954688-190954710 CGCTTGAGCCCAGGGGGTTAAGG - Intergenic
968122996 3:196139524-196139546 CGCTTGAGCCTCGGAGGTTGAGG - Intergenic
968673162 4:1863138-1863160 CGCTTGAGCCTCGGAGGTCAAGG + Intergenic
969044589 4:4327693-4327715 CGCTGTAGCCCTGGGAGTTCAGG - Intergenic
969358875 4:6648618-6648640 CGCTTGAGCCTGGGTGGTTAAGG - Intergenic
969624923 4:8297548-8297570 GGCTGTGGCCTCGAGGGTGAGGG + Intronic
969699170 4:8756933-8756955 CTCTGTGGCCTAGGGGGTTGGGG - Intergenic
972229858 4:37059039-37059061 TGCTGTAGCCTCCGGTTTTATGG + Intergenic
978033475 4:103966751-103966773 CACTGTAGCCTGGGTGGTCAAGG - Intergenic
985147998 4:186914190-186914212 TGCTTGAGCCTGGGGGGTTAAGG + Intergenic
988323462 5:29731369-29731391 CGCTTGAACCTCGGGGGTTGAGG - Intergenic
989369388 5:40690254-40690276 TGCTGGAGCCTAGGGGGTCAAGG + Intronic
992815586 5:80434558-80434580 TGCTTGAGCCTCGGGGGTTGAGG - Intronic
994615564 5:102100038-102100060 CTCTGTGGCCTCTGGGGTCATGG - Intergenic
997937366 5:138125004-138125026 CACTGGAGCCTAGGAGGTTAAGG - Intronic
998006828 5:138662592-138662614 CGCTGGAGCCTGGGTGGTTGAGG + Intronic
999460141 5:151750728-151750750 CGCTTGAGCCTGGGAGGTTAAGG - Intronic
1000333894 5:160227600-160227622 CACTGGAGCCTGGGAGGTTAAGG + Intronic
1001643325 5:173261036-173261058 CGCTTGAGCCTCGGAGGTTGAGG + Intergenic
1003024379 6:2541361-2541383 CGCTTGAGCCTGGGAGGTTAAGG - Intergenic
1004364741 6:15002437-15002459 TGCTTGAGCCTCGGAGGTTAAGG - Intergenic
1004516210 6:16324365-16324387 CGCTGGAGCCTAGGAGGTCAAGG + Intronic
1004530879 6:16454436-16454458 CTCTGTAGCCTCAGGGGTCAAGG + Intronic
1005352972 6:24954537-24954559 CGCTTAAGCCTGGGAGGTTAAGG - Intronic
1006903866 6:37520264-37520286 CGCTTGAGCCTTGAGGGTTAAGG - Intergenic
1006924777 6:37648335-37648357 ATCTGTAGCCTCAGGGGTCAAGG + Intronic
1007456719 6:41983760-41983782 CGCTTGAGCCTGGGAGGTTAAGG + Intronic
1015535629 6:134264724-134264746 CGCTTGAGCCTAGGAGGTTAAGG - Intronic
1018544784 6:164923574-164923596 CGCTGGAGCCTGGGAGGTCAAGG - Intergenic
1019879011 7:3842013-3842035 GGCTGTAGCCTCAGGGGTAAGGG + Intronic
1020279166 7:6641622-6641644 CGCTGTAGCCTCTAGGGCTTTGG + Intronic
1022552642 7:31255794-31255816 CGCTTGAGCCTGGGAGGTTAAGG + Intergenic
1024895260 7:54252714-54252736 CGATGAATCCTCGGGGGTCAGGG + Intergenic
1024980948 7:55157094-55157116 CCCTCTACCCTCAGGGGTTATGG - Intronic
1027762300 7:82295418-82295440 CGCTGGAGCCTGGGGGGTCAAGG - Intronic
1029304230 7:99607069-99607091 CACTTTAGCCTGGGAGGTTAAGG - Intronic
1029585246 7:101466604-101466626 CGCTTGAGCCTCGGAGGTTGAGG + Intronic
1029734611 7:102458652-102458674 CGCTAGAGCCTGGGGGGTCAAGG + Intronic
1030432445 7:109468012-109468034 CGCTTGAGCCTGGGAGGTTAAGG + Intergenic
1032048753 7:128632754-128632776 CGCTTTAGCCTAGGAGGTCATGG - Intergenic
1036550671 8:9812745-9812767 GGTTGTAGCCTCGGGGTTTTGGG + Intergenic
1037922323 8:22816089-22816111 CGCTCTAGCCTTGGGGGGTGAGG + Intronic
1038319477 8:26514096-26514118 CGCTGTAGCCGCGGGGGGCGTGG + Intergenic
1038504015 8:28068818-28068840 CGCTTGAGCCTAGGAGGTTAAGG - Intronic
1039989392 8:42475181-42475203 CGCTTGAGCCTGGGCGGTTAAGG - Intronic
1040070471 8:43183248-43183270 CGCTTGAGCCTGGGAGGTTAAGG - Intronic
1042909926 8:73816273-73816295 CACTGAAGCCTTGGGGGTCAAGG - Intronic
1044691698 8:94886615-94886637 CACTGTAGCCTCGGAGGTCGAGG + Intronic
1047535511 8:125715875-125715897 CGCTGTAATCTCAGGGGTTTGGG + Intergenic
1050641754 9:7675778-7675800 CGCTGGAGCCTGGGAGGTAAAGG + Intergenic
1052316210 9:27118548-27118570 CGCTTTAGCCTGGGGGTTTTAGG + Intronic
1053752757 9:41273398-41273420 CTCTGCAGCCACGGGGGATAGGG + Intergenic
1054258282 9:62837750-62837772 CTCTGCAGCCACGGGGGATAGGG + Intergenic
1054770085 9:69075374-69075396 CGCTGTAACCTGGGGGGTGGAGG + Intronic
1058895749 9:109399243-109399265 TGCTCTAGCCTCGGAGGTTGAGG - Intronic
1059217214 9:112575216-112575238 TGCTGTGGCCTCAGTGGTTATGG - Exonic
1062429481 9:136520652-136520674 CGCTTTAGCCTGGGAGGTCAAGG + Intronic
1202800491 9_KI270719v1_random:170625-170647 CTCTGCAGCCACGGGGGATAGGG - Intergenic
1186181751 X:6980290-6980312 CACTTTAGCCTAGGAGGTTAAGG - Intergenic
1186654590 X:11598972-11598994 TGCTTGAGCCTGGGGGGTTAAGG + Intronic
1193129912 X:77908736-77908758 CGCTTTAGCCCCGGAGTTTAAGG + Intergenic
1196913014 X:120502755-120502777 CGCTGGAGCCTGGGAGGTTGAGG + Intergenic