ID: 1114648394

View in Genome Browser
Species Human (GRCh38)
Location 14:24268329-24268351
Sequence CAAAACAAGGAGAGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114648394_1114648404 27 Left 1114648394 14:24268329-24268351 CCAGAGCCCCTCTCCTTGTTTTG 0: 1
1: 0
2: 4
3: 46
4: 332
Right 1114648404 14:24268379-24268401 GCTCGTCTGTCGTGGAGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 41
1114648394_1114648403 19 Left 1114648394 14:24268329-24268351 CCAGAGCCCCTCTCCTTGTTTTG 0: 1
1: 0
2: 4
3: 46
4: 332
Right 1114648403 14:24268371-24268393 GAATAGCTGCTCGTCTGTCGTGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114648394 Original CRISPR CAAAACAAGGAGAGGGGCTC TGG (reversed) Intronic
900743549 1:4344855-4344877 CAAGACAAGAAGATGGGCTGGGG - Intergenic
901385877 1:8908848-8908870 CAAGACAAAGGGATGGGCTCTGG + Intergenic
901528290 1:9837745-9837767 CAAGCCAAGGAGAGCGGCCCGGG + Intergenic
902851294 1:19159589-19159611 AAAAAAAAGGAGTGGGGCTGGGG - Intronic
904324042 1:29715938-29715960 CAAAATAAGGGGATGGGCTCTGG - Intergenic
904324247 1:29717520-29717542 CAAAATAAAGGGATGGGCTCTGG + Intergenic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905482458 1:38270949-38270971 CAAATCGAGGAGAGAGTCTCAGG + Intergenic
905872326 1:41412197-41412219 AAAAACAAGGAGAGGCCATCAGG + Intergenic
907297212 1:53462899-53462921 CCACACAAAGAGAGGGGCTCTGG + Intronic
907325969 1:53638739-53638761 CAGAACAAGGAGTGGGGCAGGGG + Intronic
910485334 1:87707224-87707246 CCAAACAAAAAGAGGGACTCTGG + Intergenic
912386791 1:109274768-109274790 CAGGAAAAGGAGAGGGGCTGGGG - Exonic
912527658 1:110296324-110296346 AAAAAGGAGGAGAGGGGCTGGGG - Intergenic
912764491 1:112396329-112396351 CAAAGCAAGGATAGGGGCACCGG + Intronic
914927482 1:151901011-151901033 CAAAACAAAGGGATGGGCTCTGG - Intronic
916703539 1:167322807-167322829 GGAAACAAAGAGATGGGCTCTGG + Intronic
916740710 1:167644822-167644844 TTAGACAGGGAGAGGGGCTCTGG - Intronic
917571074 1:176266046-176266068 CACAGCAAGGAGAGGGCCTGAGG - Intergenic
917753072 1:178071872-178071894 CTAAAAGATGAGAGGGGCTCAGG + Intergenic
918091143 1:181296227-181296249 CAGAATGAGGAGAGGGGCCCTGG - Intergenic
918130389 1:181622483-181622505 CAAGCCAAGGAGAGAGGCTCAGG - Intronic
918155419 1:181841297-181841319 AAAAACAAGAAGTGGGGCTGGGG - Intergenic
918699300 1:187587601-187587623 CAAGCCAAGGAGAAAGGCTCAGG - Intergenic
919138705 1:193542982-193543004 CCAAAAAAGGAGAAGGGATCTGG - Intergenic
919831209 1:201541355-201541377 AAAAAGAAGTAGAGGGGGTCTGG - Intergenic
920377390 1:205516491-205516513 CAAAACAAAAAGAGGGACTTGGG + Intronic
920529875 1:206694039-206694061 CAAGATGAGGAAAGGGGCTCAGG + Intronic
921298561 1:213727654-213727676 CAAAAGAAGGGGAGGGGACCAGG + Intergenic
922327881 1:224545939-224545961 CAAACCAAGGAGAGGGGCCTCGG - Intronic
923056939 1:230433803-230433825 CAAAACTGGGAAAGGGGCTTTGG - Intergenic
923315764 1:232778695-232778717 CAAAACAAGGCTGGGAGCTCTGG + Intergenic
924039944 1:239974667-239974689 CAAGACAAGGCCAGGTGCTCTGG + Intergenic
924460268 1:244252938-244252960 CAAAAAAAGGAGATGGGCAATGG - Intergenic
1063493023 10:6482506-6482528 CAAAGCATGGAGAGGGGCCTGGG + Intronic
1066206570 10:33195225-33195247 CTAAACAAGCAGAGGTGCTCAGG + Intronic
1067016060 10:42756877-42756899 CAAAACTAGGAGCGGAACTCAGG - Intergenic
1067275300 10:44828451-44828473 GAAAACAACAAGGGGGGCTCGGG + Intergenic
1067716492 10:48694707-48694729 AAAAGCAGGGACAGGGGCTCAGG - Intronic
1068031250 10:51708170-51708192 CAAGCCAAGGAGAGAGGATCAGG - Intronic
1068629623 10:59285850-59285872 CAAGACAAGGAGAGAGGCTCAGG + Intronic
1070091165 10:73286872-73286894 CGAAACAAAGGGATGGGCTCTGG + Intronic
1070714721 10:78711080-78711102 CATATCAAGGAGAGAGGCCCAGG - Intergenic
1070769498 10:79074043-79074065 CATACAAAGGAGAGGGGCTGTGG - Intronic
1071096600 10:81982600-81982622 CAAGCCAAGAAGAGAGGCTCAGG - Intronic
1074211967 10:111343486-111343508 AAACACAAGGAGAGGGAGTCTGG - Intergenic
1074440480 10:113473396-113473418 CTAAACAATGTGAGGGGCTGGGG + Intergenic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1078096687 11:8301703-8301725 CCAGACTAGGAGAAGGGCTCTGG + Intergenic
1081351720 11:42061799-42061821 CAAACCAGGGAGAGAGGCTTCGG + Intergenic
1082965953 11:58966308-58966330 CAAAACAGAGGGATGGGCTCTGG - Intronic
1083362581 11:62121273-62121295 GAAAAAAAGGAGGGGGGCTGAGG - Intergenic
1083362595 11:62121368-62121390 GAAAAAAAGGAGGGGGGCTGAGG - Intergenic
1083763065 11:64829246-64829268 AAACAAAAGGAGAGCGGCTCAGG + Intronic
1083862567 11:65430266-65430288 CAGAAAAGGGAGAGGGGCCCAGG - Intergenic
1084394730 11:68901750-68901772 CAAAACCAGGAGAGAAGCCCTGG - Intronic
1084409188 11:68996733-68996755 CAGAACAGGGCGAGCGGCTCAGG - Intergenic
1084530261 11:69723148-69723170 CACGCCAGGGAGAGGGGCTCAGG + Intergenic
1085121519 11:73970371-73970393 CAAAGCCAGGACAGGGACTCAGG - Intergenic
1086392101 11:86375408-86375430 CAAAACCAGAAAAGGGTCTCTGG - Intronic
1088058153 11:105610277-105610299 GAAAACCAAGAGAGGGGCGCTGG + Exonic
1088977027 11:114825077-114825099 CCAAAAGTGGAGAGGGGCTCTGG + Intergenic
1091370779 11:135056331-135056353 CTAGACAAGGAGATGGGGTCAGG - Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092883379 12:12905270-12905292 CAAAACAAGAGGAAGGACTCGGG - Intronic
1093895425 12:24569570-24569592 CAAAACAAGATGAGGGGCAAGGG + Intergenic
1094728880 12:33151871-33151893 CAAAACAAAGGGATGGGCCCTGG + Intergenic
1095855786 12:46859666-46859688 CAAAACAGGGAGGGGGCTTCAGG + Intergenic
1096386478 12:51198101-51198123 CACAAGAAGGAGAGGGGGTTGGG + Intronic
1096494815 12:52033842-52033864 CTGAATAAGGAGAGGGGCTGTGG - Intronic
1096606834 12:52772671-52772693 CAAAACCAGCAATGGGGCTCAGG - Intronic
1096804922 12:54134770-54134792 CCATTCAAGCAGAGGGGCTCTGG - Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1097219796 12:57441973-57441995 CAAAACCATGAGAGTGGCTGGGG - Intronic
1097345473 12:58487455-58487477 TAAATCAAAGAGAGGGGCTCTGG + Intergenic
1097548173 12:61031251-61031273 CAAAACAAAGGGATGGGCTCTGG + Intergenic
1097935724 12:65248928-65248950 CAAAACAGGCAGAGGAACTCTGG + Intergenic
1098253648 12:68594402-68594424 AAAAACAAGGCCAGGGGCTGTGG - Intergenic
1098385944 12:69918497-69918519 CAATACAAGGAGTGGGGTGCAGG + Intronic
1100594111 12:96056690-96056712 CAAAATATGGAGAGGGCCTCTGG - Intergenic
1101439389 12:104692015-104692037 CAAAACAAGGAGACACGCTGAGG - Intronic
1101658705 12:106747263-106747285 CAAAACAAAGACAGGGGATGGGG + Intronic
1102322229 12:111946441-111946463 CAAAACAAAGAGATGGGCTCTGG + Intronic
1104337383 12:127912213-127912235 CACAACAAGGAGAGGTCTTCTGG - Intergenic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1105492132 13:20899095-20899117 CAAAAGAAAGGGAGGGGATCGGG + Intronic
1105788215 13:23770418-23770440 TAAAAAAAGGGGAGGGGGTCAGG + Intronic
1105856101 13:24373494-24373516 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1106017793 13:25885449-25885471 CAAAAGAAGGAGAGAGGGCCAGG - Intronic
1107715639 13:43196688-43196710 TTAAACATGGAGAGGAGCTCTGG + Intergenic
1109933516 13:69247825-69247847 CAAAAAATGGAAAGGGGTTCTGG - Intergenic
1110025306 13:70530316-70530338 CAAAACAAGGAGAGAGGCCTAGG - Intergenic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1113913275 13:113854816-113854838 CACTACAAGGAGAGAGGCCCAGG + Intronic
1114162130 14:20179797-20179819 CAACTCTAGTAGAGGGGCTCTGG - Intergenic
1114622547 14:24105148-24105170 CAAAATGAAGAGATGGGCTCTGG + Intronic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1116238770 14:42313916-42313938 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1117631173 14:57693533-57693555 CAAAATAAAGGGATGGGCTCTGG - Intronic
1118014523 14:61645014-61645036 CAAGCCAGGGACAGGGGCTCAGG + Intronic
1118379385 14:65205136-65205158 CAAAACAAGAACATGGGCTGTGG + Intergenic
1118479132 14:66145666-66145688 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1118793366 14:69116386-69116408 CAAAGGAAGGAGTGGGACTCTGG - Exonic
1118949914 14:70426690-70426712 CGAAACAAAGGGATGGGCTCTGG + Intergenic
1120028533 14:79613464-79613486 CAAAACAAGGACAGGGTCTGAGG - Intronic
1120834109 14:89025593-89025615 GAAAACCTGGAGAGAGGCTCTGG + Intergenic
1120849519 14:89156903-89156925 AAAAAGGAGGAGAGGGGCTGGGG + Exonic
1121438514 14:93934301-93934323 CAGAACAAGTGGAGGGGCACAGG + Exonic
1122720235 14:103717716-103717738 CCAAACATGGTGGGGGGCTCTGG - Intronic
1122909514 14:104820383-104820405 CAAGCCAAGGAGGGGGCCTCTGG - Intergenic
1128616174 15:69111727-69111749 CAAAAAAAAGAGAGGAGATCAGG + Intergenic
1128886794 15:71295364-71295386 CTGAACCAGGAAAGGGGCTCAGG - Intronic
1129220569 15:74129521-74129543 CATAACCAGGAAAGGGGTTCAGG - Exonic
1129267831 15:74403505-74403527 CAAAACAGGGAGACAGGCCCTGG + Intergenic
1129908388 15:79206100-79206122 CAAAAGGAGGAGAGGGACACTGG + Intergenic
1131037610 15:89233951-89233973 CAAAACAAAGGGGTGGGCTCTGG + Intergenic
1131578319 15:93614457-93614479 CAAAACAAGGAAAGAGATTCTGG - Intergenic
1132038872 15:98507908-98507930 GAAAACAGGGTGAGGGGCCCGGG + Intronic
1132040939 15:98524168-98524190 CACAACAACGAGAGGAGCTGGGG + Intergenic
1132239302 15:100245329-100245351 CAGAACAATGAAGGGGGCTCTGG + Intronic
1133009265 16:2901331-2901353 AAAGAACAGGAGAGGGGCTCCGG - Intergenic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1133779730 16:8928678-8928700 CAAACCAAGGAAAGGTGCTACGG + Intronic
1134223621 16:12374788-12374810 CAAAACAGTGAGAGGTGCCCAGG - Intronic
1135404887 16:22190729-22190751 CAAAACATGGAAAGAGACTCGGG - Exonic
1135938204 16:26798744-26798766 CAGAACAACAAGAGGGGCACTGG + Intergenic
1136638301 16:31539970-31539992 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1136659126 16:31739944-31739966 CAAAATAAAGGGATGGGCTCTGG - Intronic
1138982388 16:62285463-62285485 CAAGACAAAGAGAGGGGTTTGGG + Intergenic
1139448875 16:67014804-67014826 AAAAAAAAGGAGGGGGGCGCTGG + Intergenic
1139833009 16:69815492-69815514 AAAAAAAAGGAGAGGGGCAGGGG + Intronic
1140268321 16:73439942-73439964 AAAAACAAGGAGAAGGGCCAAGG + Intergenic
1142062734 16:88041082-88041104 CAGCACAAGGAAAGGGGCTGGGG - Intronic
1142204880 16:88778191-88778213 CAAAAGCAGGAAGGGGGCTCGGG - Intronic
1143021048 17:3917373-3917395 CAAAACGAGGGGTGGGGCTGGGG - Intergenic
1143345273 17:6244587-6244609 CAAAGCAGGGATGGGGGCTCGGG - Intergenic
1144078867 17:11744174-11744196 CAAATCAAGTAGAGGAGCTTGGG + Intronic
1144129936 17:12236874-12236896 AAAAAGGAGGAGAGGGGCTGGGG + Intergenic
1144858375 17:18283765-18283787 CAAACCAAGGAGGGGGTCTGAGG - Intronic
1145016574 17:19402679-19402701 CAAGGCAAGGAGAGTGGCTGGGG + Intergenic
1145260734 17:21352910-21352932 CCAAACAGGGAGAGGGACACTGG - Intergenic
1147042524 17:37729744-37729766 CAAAACAAGGACTAGAGCTCAGG - Intronic
1147950703 17:44106178-44106200 AAAAACAAGAAGAGGGGATGAGG + Intronic
1148492250 17:48030804-48030826 CAAAACAAGATGCAGGGCTCTGG - Intronic
1148544853 17:48509947-48509969 AAAAACAAGGCGAGGTGCTGTGG + Intergenic
1148639006 17:49170882-49170904 CGAAACAAAGGGATGGGCTCTGG + Intergenic
1148937244 17:51173295-51173317 CAAGAAGAGGAGAGGGGCTAAGG + Intergenic
1149647388 17:58250049-58250071 CAGGAATAGGAGAGGGGCTCTGG - Intronic
1155004230 18:21713740-21713762 AAAAAAAAGGAGAGGGGTGCAGG - Intronic
1155712733 18:28903217-28903239 CAAATCAAGGTGAGGGGCTCGGG - Intergenic
1157089874 18:44624937-44624959 CAAAACAAGGATGGAAGCTCAGG - Intergenic
1158605797 18:58895033-58895055 GAAAAGAAGGAGAATGGCTCAGG - Intronic
1158739572 18:60124625-60124647 AAAAAGTAGGAGAGGGGCTGGGG + Intergenic
1159586535 18:70288669-70288691 AAAAACCAGGACAGGGACTCTGG + Intergenic
1159609166 18:70507501-70507523 CAAACCAAGGAGAGAGGCTGTGG - Intergenic
1160097599 18:75889701-75889723 CCAAAGAAGGAGAGAGGGTCAGG - Intergenic
1160111355 18:76034673-76034695 GAAAACAAGGGGAGGGGGTGAGG - Intergenic
1160961097 19:1721203-1721225 CAGAGCCAGGAGAGGGGCACGGG + Intergenic
1161400979 19:4066167-4066189 AAAAACAGGGAGGGGGGCTTCGG - Intronic
1163177952 19:15577589-15577611 TAAACCAATGAGAGGGACTCAGG - Intergenic
1164545482 19:29158319-29158341 CAGATCCAGCAGAGGGGCTCTGG + Intergenic
1165245736 19:34497518-34497540 GAAAAGAAGGAGTGGGGGTCAGG + Intronic
1166986843 19:46665626-46665648 AAAGACAAGGAGAGAGGCACAGG - Intergenic
1167152496 19:47718426-47718448 GAAAACATGAAGAGGGACTCGGG - Intronic
1168246441 19:55115012-55115034 CAAGCCCAGGAGAGGCGCTCAGG - Intronic
925071920 2:976523-976545 CAAAACTCGGAGAAGAGCTCAGG - Intronic
925777622 2:7350133-7350155 CAAAATCAGGACAGGGGCTTAGG - Intergenic
927844724 2:26465475-26465497 CAAAACAAGGAGAGGGACAGTGG - Intronic
927868466 2:26608250-26608272 AAAAAAAAGGAGAGTGGGTCTGG + Intronic
928071850 2:28224984-28225006 CAAAAAAAGGAGAGTGGATAGGG + Intronic
928112429 2:28521722-28521744 TAAGACCAGGAGAGGGGCTGTGG - Intronic
929431930 2:41894346-41894368 CAAGCCAAGGAGAGGGGCCTCGG + Intergenic
930280784 2:49367440-49367462 CAGAACAAGAAGACAGGCTCAGG + Intergenic
931536846 2:63287024-63287046 CAAGCCAAGGAGAGAGGTTCAGG - Intronic
931833857 2:66079033-66079055 AAAAACATGGAGCGGGGGTCGGG + Intergenic
932892014 2:75605684-75605706 AAAAACAGAGAGAAGGGCTCAGG - Intergenic
933876056 2:86623174-86623196 CACAGAAAGGAGAGGGGCGCGGG + Exonic
935063811 2:99631063-99631085 CAGAACACGGAGTGGGGCTCAGG + Intronic
935915844 2:107948390-107948412 CAAAACAAAGGGATGGGTTCTGG + Intergenic
936471687 2:112804484-112804506 CAAGACAAAGAGATGGGCTAAGG + Intergenic
936771170 2:115915174-115915196 CAAAACAAAGAGATGGGCTCTGG - Intergenic
937337760 2:121072293-121072315 CAAGAGAGGGAGAGAGGCTCAGG + Intergenic
938141654 2:128799451-128799473 CCAAGGAAGGAGAGGGGCCCTGG - Intergenic
938142402 2:128806941-128806963 CAAAACAAGAACAGAGCCTCAGG - Intergenic
938146008 2:128835437-128835459 CAGCAGCAGGAGAGGGGCTCTGG - Intergenic
940157921 2:150678695-150678717 CAAAAGAAGGGGAGGTGCTATGG + Intergenic
941249621 2:163146266-163146288 CAAAACAAAGGGATGGGCTCTGG + Intergenic
941498787 2:166242211-166242233 CAAAACAGGGAGAGAGTCTGTGG - Intronic
942021397 2:171869702-171869724 CAACTCAAGGAGAAGGGCTTTGG - Intronic
942229588 2:173847680-173847702 GGAAACATGGAGAGGGGCTCTGG + Intergenic
943255159 2:185585287-185585309 CAAAACAAAGGGATGTGCTCTGG + Intergenic
943651112 2:190458408-190458430 CAAGCCAACGAGAGGGGCCCTGG + Intronic
943907509 2:193518278-193518300 GCAAAGAAGGAGAGGGGATCTGG - Intergenic
944311934 2:198243313-198243335 TAAGGCAAGGAGAGAGGCTCAGG - Intronic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
948015972 2:234690900-234690922 GAAGACAAAGAGAGGGGCTAGGG - Intergenic
948161208 2:235826442-235826464 CAAAAAAAGGAGTGGGGGTGGGG - Intronic
948756338 2:240161645-240161667 CAAGCCAAGGAGAGGGACCCGGG - Intergenic
1169922058 20:10745818-10745840 TAAAAACAGGAGAGAGGCTCAGG - Intergenic
1170448170 20:16452106-16452128 CAACAGGAGGAGAGGGGCTCAGG + Intronic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1171970146 20:31559419-31559441 TAGAACAATGAGAGGGGCCCAGG - Intronic
1172110566 20:32542221-32542243 CAAGACAATGAGAGCTGCTCAGG + Intronic
1172252350 20:33489029-33489051 CAAAACAAGGCCAGGAGCTGTGG - Intergenic
1172511001 20:35501056-35501078 GAAAGCAAAGAGAGGGGATCTGG + Intronic
1172519281 20:35556791-35556813 CAAGACTAGGAGAGGGGGTCTGG + Intronic
1172652611 20:36514699-36514721 CAAAACAAGGACAGGCGCGGTGG - Intronic
1173135190 20:40433240-40433262 AAAAACCAGAAGAGCGGCTCAGG + Intergenic
1173950666 20:46990796-46990818 AAAAACAACGAGGGGGTCTCAGG - Intronic
1174522699 20:51144109-51144131 TAAATCAAGGAGAAAGGCTCAGG - Intergenic
1175772331 20:61631651-61631673 GAAAAAAAAGAGTGGGGCTCAGG + Intronic
1176413918 21:6463884-6463906 CAAAGCAAGGAGAGAGGCGTCGG + Intergenic
1177915879 21:27087680-27087702 CAAAATAAGAAGAGAGGCTTGGG + Intergenic
1178179215 21:30140635-30140657 CAAAACAAGGACATGGGCCTTGG + Intergenic
1178438201 21:32577944-32577966 CAAAACAAAGGGATGGGCTCTGG + Intronic
1179138209 21:38699186-38699208 CAGAACAAAGAGAGGAGCACTGG + Intergenic
1179400396 21:41077445-41077467 AAAGCCAAGGAGGGGGGCTCAGG - Intergenic
1179689416 21:43072206-43072228 CAAAGCAAGGAGAGAGGCGTCGG + Intronic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1180869150 22:19136755-19136777 CAAAACATGGGGAGAGGTTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1181558627 22:23686691-23686713 AAACACAGGGAGAGGGGCCCTGG + Intergenic
1181825075 22:25508436-25508458 AAAAAAAAGAAGATGGGCTCTGG - Intergenic
1182528497 22:30937253-30937275 TAAAAAAGGGAGAGGGGCTGGGG - Intronic
1182733234 22:32512079-32512101 CCACAGAAGGAGAGGGTCTCTGG + Intergenic
1182892879 22:33833485-33833507 CAAGCCAAGGAGAGAGGCCCTGG + Intronic
1183009335 22:34932032-34932054 GAAACCCAGGGGAGGGGCTCTGG + Intergenic
1183586250 22:38754946-38754968 CAAAACAAGAAGTGAGCCTCTGG + Intronic
1184450120 22:44577705-44577727 CAGAACAAGGAGAGCATCTCAGG - Intergenic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949388946 3:3537578-3537600 CAAAACCAGGACTGGGGCTCCGG - Intergenic
951044743 3:18025237-18025259 CAAAACAAAGAGAGGCTCTGAGG + Intronic
952517444 3:34120110-34120132 GAAAACAAAGGGATGGGCTCTGG - Intergenic
953137904 3:40199425-40199447 CAAAACAGGGAGGGGAGCTGTGG - Intronic
953223874 3:40998912-40998934 CAAAACAAGGAGTCCGGCTGGGG - Intergenic
953701593 3:45200127-45200149 CAACACAAGGAAAGGCTCTCAGG + Intergenic
953835021 3:46334930-46334952 CAAAACAAAGGGATGGGCTCTGG - Intergenic
954036227 3:47852657-47852679 CAAAGCAGGGAGATGGGCCCAGG + Exonic
954217545 3:49132912-49132934 CAAAGCAAGGAGGAGGGCTCGGG - Intronic
954231236 3:49219390-49219412 CAAAACAAAGGGATGGACTCTGG - Intronic
956144786 3:66181761-66181783 AAAGACAAGGGGAGGGGATCAGG - Intronic
956674454 3:71721380-71721402 TAAAACAGGGTCAGGGGCTCGGG + Intronic
957365042 3:79212018-79212040 CAAAATAAAGGGATGGGCTCTGG + Intronic
958414749 3:93860400-93860422 GGAAAGAAGGAGAGGGGCTGTGG + Intergenic
959198519 3:103215716-103215738 CAAAATAAAGGGATGGGCTCTGG - Intergenic
960089812 3:113627838-113627860 CACAGGAAGGAGAGGGGCTGCGG + Exonic
960383492 3:116992458-116992480 CAAAATTAGGAGTGGGACTCTGG + Intronic
963995260 3:151701508-151701530 CTAAACAAAGGGATGGGCTCTGG - Intergenic
964130257 3:153279072-153279094 CAAAACAAGAAAAGTGGCTCAGG - Intergenic
964193310 3:154031885-154031907 CAAAAGAAGCAGAGGGGATAGGG + Intergenic
964197573 3:154082258-154082280 CAAAATAAAGGGATGGGCTCTGG + Intergenic
964466343 3:156997414-156997436 CAAAAGAAGCAGCTGGGCTCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966971161 3:185046778-185046800 CAAGACTAGGTGAGTGGCTCTGG - Intronic
968688480 4:1977111-1977133 CACATCCAGGACAGGGGCTCTGG - Intronic
968720134 4:2196456-2196478 CAAGATAGGGAGAGGGGCTGAGG + Intronic
969275858 4:6135365-6135387 CAAGCCAAGGAGAGAGGCTTCGG + Intronic
969597135 4:8155899-8155921 CAAGCCAAGGAGAGGGGCTTTGG + Intronic
969916854 4:10499770-10499792 CAAACCAAGGAGAGGGGTCGTGG - Intronic
970433203 4:16007975-16007997 CTAGACAAGGAGACGGGCTCAGG - Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
972158753 4:36197943-36197965 GAAAACAAGGAGAAGAGCTGCGG - Intronic
972947318 4:44271720-44271742 CGAAACAAAGGGATGGGCTCTGG - Intronic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
977443221 4:97097121-97097143 CAAAATAAAGGGATGGGCTCTGG + Intergenic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
979625441 4:122839928-122839950 CAAGCCAAGGAGAGGGGCCTCGG - Intronic
980592531 4:134909763-134909785 CAAAAGAAGGAGAGAAGCTTGGG + Intergenic
980762641 4:137255827-137255849 CGAAACAAAGGGATGGGCTCTGG + Intergenic
981197433 4:141938105-141938127 TGAAACAAAGAGATGGGCTCTGG + Intergenic
981197814 4:141941348-141941370 CAAAACAAAGGGATGGGTTCTGG + Intergenic
981353734 4:143763033-143763055 TAAACCAAGGAGAGGGGCACTGG - Intergenic
982282134 4:153694156-153694178 CAAAACAAAGCGATGGGCTCTGG + Intergenic
983837640 4:172411983-172412005 TAAAACAAGGAGTGGAGCACTGG + Intronic
984763011 4:183378495-183378517 CAAAATAAAGGGATGGGCTCTGG + Intergenic
988555993 5:32236552-32236574 CAAAACAAGGCCAGGCGCTGTGG + Intronic
990175357 5:53102371-53102393 CAAATCAAGGACAGTGGCCCAGG + Intronic
990948371 5:61272820-61272842 CAGAATAAAGAGAGGGGCTGAGG - Intergenic
998726063 5:145016157-145016179 CAAATCAAGGAGAGAGGCCTGGG - Intergenic
999602486 5:153282540-153282562 TAAAAAAAGGGGAGGGGATCTGG + Intergenic
1000810945 5:165860307-165860329 CAAAACAAACAGAGGTGATCAGG + Intergenic
1003112176 6:3259388-3259410 CGGGACAAGGAGAGGGGCCCGGG - Intronic
1003393652 6:5734419-5734441 TAAAGCAAGGAGAGGGTGTCAGG + Intronic
1003766817 6:9246130-9246152 CAACACAAAGTAAGGGGCTCAGG + Intergenic
1004310322 6:14539877-14539899 CAAGCCAAGGAGAGAGGCCCCGG + Intergenic
1004447624 6:15714931-15714953 CAAAACAGGGAGAGAGGTTCAGG - Intergenic
1005291205 6:24380738-24380760 CAAACCAAAGAGATGGGCTTTGG + Intergenic
1006604492 6:35246175-35246197 TCAACCAAGGTGAGGGGCTCAGG - Intronic
1006734573 6:36263896-36263918 CAAATCAAGGTGGCGGGCTCTGG - Intronic
1007099015 6:39231727-39231749 CCAAACAAAGAGAGGGCCTGTGG - Intergenic
1007480917 6:42149240-42149262 GCATTCAAGGAGAGGGGCTCAGG + Intergenic
1007671243 6:43555933-43555955 CACAACAAGGAGAGGTGATGAGG - Exonic
1007886464 6:45235980-45236002 CAAAACAAAGGGATGGGCTCTGG - Intronic
1007887032 6:45241448-45241470 CGAAACAAAGGGATGGGCTCTGG - Intronic
1011813348 6:91158766-91158788 AAAAACAAGGGGAGGAGGTCAGG - Intergenic
1013420040 6:109959246-109959268 GAAAACAAGGAGAGGGACTGTGG - Intergenic
1013519183 6:110917004-110917026 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1013519790 6:110922830-110922852 CAAAACAAAGGGATAGGCTCTGG - Intergenic
1014143802 6:117973136-117973158 CAAGCCAAGGAGAGAGGCTTTGG - Intronic
1014863888 6:126505117-126505139 CAAAATAAAGGGATGGGCTCTGG - Intergenic
1015159657 6:130138388-130138410 CAAGTCAAGGAGAGAGGCCCAGG - Intronic
1017587037 6:155937815-155937837 CAAAAGAAGGAGTGGGGAACAGG + Intergenic
1018087776 6:160319797-160319819 CAAAACAAGGATAGATGATCAGG + Intergenic
1018887874 6:167956826-167956848 CAGGAAAAGGAGAGAGGCTCTGG - Intronic
1020054823 7:5110345-5110367 CAAAACAAAGGGATGGGCTCTGG + Intergenic
1022597980 7:31731020-31731042 CAAATCATGGAGAGGGGGGCGGG + Intergenic
1022850784 7:34259515-34259537 CAAGCCAAGGAGAGGGGCCCTGG + Intergenic
1023027370 7:36062889-36062911 CTAAACAAGAAGAGGGGTCCTGG + Intergenic
1023283149 7:38592098-38592120 CAAAACAAAGGGATAGGCTCTGG + Intronic
1023804223 7:43859922-43859944 CGAAACAAAGGGATGGGCTCTGG + Intergenic
1024791311 7:52967802-52967824 CAAGCCAAGGAGAGAGGCACAGG - Intergenic
1025819687 7:64950537-64950559 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1025886666 7:65601172-65601194 CTAAACAGGGAGAGGGGACCAGG + Intergenic
1026675699 7:72426183-72426205 CAGAAGAAGGTGAGGGGCCCAGG + Intronic
1028211984 7:88084896-88084918 CAAACCAAGGAGAGAGGCCTCGG - Intronic
1028316614 7:89410039-89410061 CAAGCCAAGGAGAGAGCCTCGGG - Intergenic
1028779712 7:94722528-94722550 CGAAACAAAGGGATGGGCTCTGG + Intergenic
1028780411 7:94729036-94729058 TGAAACAAAGAGATGGGCTCTGG + Intergenic
1031855754 7:126920770-126920792 CTAAACAGGGAGAGGGGACCAGG - Intronic
1032725704 7:134588456-134588478 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1034241885 7:149617219-149617241 CAAAACAAGGGCAAGGGCACTGG + Intergenic
1035319830 7:158021679-158021701 CCAACCAAGGAGAGGGGCCTCGG + Intronic
1035423879 7:158753982-158754004 TAAAACAAGGAGAGAGGCTGCGG + Intronic
1035600396 8:893844-893866 CACAGCAAGAGGAGGGGCTCGGG - Intergenic
1035627039 8:1078158-1078180 CTAAACCAGGAGAGCGTCTCTGG - Intergenic
1036506717 8:9363601-9363623 GACAACAAAGAGAGGGGCTCTGG + Intergenic
1036656864 8:10682458-10682480 CAAGCCAAGGAGAGAGGCTTCGG - Intronic
1036707599 8:11056764-11056786 CAAGACATGGAAAAGGGCTCAGG - Intronic
1037688550 8:21163942-21163964 GAAAACGAGCAGAGAGGCTCAGG - Intergenic
1038284814 8:26197360-26197382 CAAGCCAAGGAGAGAGGCTCAGG - Intergenic
1038372631 8:27009410-27009432 CAAGCCAAGGAGAGAGGCTCAGG + Intergenic
1038441312 8:27572637-27572659 CAAGCCAAGGAGAGAGGCTCAGG - Intergenic
1038718878 8:30015463-30015485 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1040955945 8:52980079-52980101 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1042483419 8:69327823-69327845 AAAAACATGAAGAGGGTCTCAGG - Intergenic
1044754978 8:95451959-95451981 CCAAACAAGGAAAGAGCCTCAGG + Intergenic
1044777936 8:95713244-95713266 GAAAATAAGCAGAGGGGATCTGG + Intergenic
1045620947 8:103977742-103977764 CAAACTAAGGAGAGGGGCTATGG - Intronic
1046673428 8:117082843-117082865 CAAGACAAGGACAAGAGCTCAGG + Intronic
1047500788 8:125439587-125439609 CAAAACACTGGGAGGGCCTCAGG + Intergenic
1049442456 8:142615537-142615559 CCATATAAGGAGCGGGGCTCCGG + Intergenic
1050021001 9:1284574-1284596 CTAAAGAACGTGAGGGGCTCAGG + Intergenic
1050243186 9:3659375-3659397 CAAACCAAGGAGATGGACTGTGG - Intergenic
1051744866 9:20285889-20285911 CAAGCCAAGGAGAGAGGCTCAGG + Intergenic
1052065227 9:24010210-24010232 AAAAAATCGGAGAGGGGCTCTGG - Intergenic
1052606359 9:30707655-30707677 GGAAACAAAGGGAGGGGCTCTGG + Intergenic
1054160756 9:61670861-61670883 CAAAACAAAGAGTGGGGTCCAGG + Intergenic
1055162650 9:73149473-73149495 CAAAACAAGGAGAGGAAATATGG - Intergenic
1055813276 9:80177106-80177128 AAAAACAAGGAGTGAAGCTCTGG + Intergenic
1056584402 9:87919063-87919085 AAAAACAGGAAGAGGGGGTCGGG - Intergenic
1056612465 9:88133844-88133866 AAAAACAGGAAGAGGGGGTCGGG + Intergenic
1056984297 9:91347025-91347047 CAAAACAAAAAATGGGGCTCAGG - Intronic
1057353049 9:94316367-94316389 CAAAACAAGGACAGGGACAGTGG + Intergenic
1057654697 9:96941224-96941246 CAAAACAAGGACAGGGACAGTGG - Intronic
1058200970 9:102040072-102040094 CAAAACAAGGAAGGGAGCTGAGG - Intergenic
1058520464 9:105810471-105810493 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1060025840 9:120170589-120170611 GAGAAGAAAGAGAGGGGCTCGGG - Intergenic
1060187885 9:121574987-121575009 CATAACAAGGTCAGGGGCTGAGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060748987 9:126156341-126156363 CCAAATAAGGAAAGAGGCTCAGG + Intergenic
1062347235 9:136120616-136120638 CACAGCAAGGAGCGGGGCTGTGG - Intergenic
1185661636 X:1733203-1733225 GAAAAAAAGGAGAGGGGGCCGGG + Intergenic
1188768584 X:34126264-34126286 CAACAGAATGAGAGGTGCTCTGG + Intergenic
1189110369 X:38283530-38283552 CAAAACCAGAAGAAGGGCTTTGG + Intronic
1189214957 X:39314939-39314961 CACATCAAGGAAAGGGGCACAGG - Intergenic
1190713884 X:53088243-53088265 CAGCACAGGGAGAGGGGCTGGGG - Exonic
1191149262 X:57203255-57203277 CAAAACAAAGGGATGGGCTCTGG + Intergenic
1191149806 X:57208780-57208802 CATAACAAAGGGATGGGCTCTGG + Intergenic
1191227168 X:58055380-58055402 CAAAACTAAGGGATGGGCTCTGG - Intergenic
1192191735 X:68995320-68995342 CAAAACCAGGACAGGAGATCAGG - Intergenic
1192201354 X:69068623-69068645 CAAAATAGGGGGAGGGGCCCTGG + Intergenic
1192938685 X:75889319-75889341 AAAAAGGAGGAGAGGGGCTGGGG - Intergenic
1193146963 X:78086489-78086511 CAAACCAAGGAGAGAGGCCTGGG + Intronic
1193209280 X:78786686-78786708 CGAAACAAAGGGATGGGCTCTGG - Intergenic
1193405545 X:81096591-81096613 CTTAAAAAAGAGAGGGGCTCTGG + Intergenic
1194057320 X:89151595-89151617 CACAACAAAGGGATGGGCTCTGG - Intergenic
1194162205 X:90467964-90467986 GGAAACAAGGGGATGGGCTCTGG + Intergenic
1194543565 X:95204756-95204778 CAAAACAAAGGGATGGGCTCTGG - Intergenic
1195200521 X:102546260-102546282 TAAAAGGAGGAGAGGGGCTGGGG + Intergenic
1196683683 X:118493934-118493956 AAAAAAAAGGAGAGAGGCCCAGG - Intergenic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1198004281 X:132476172-132476194 CAGATCCAGGAGAGGAGCTCTGG - Intronic
1198109958 X:133494389-133494411 GAAAACAAAGAAGGGGGCTCAGG - Intergenic