ID: 1114649224

View in Genome Browser
Species Human (GRCh38)
Location 14:24273006-24273028
Sequence ACCTTCTTTGCAGTAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649224_1114649229 6 Left 1114649224 14:24273006-24273028 CCTGTGCCTACTGCAAAGAAGGT No data
Right 1114649229 14:24273035-24273057 GTGGAGCCTTTATGAGGTTCAGG No data
1114649224_1114649228 0 Left 1114649224 14:24273006-24273028 CCTGTGCCTACTGCAAAGAAGGT No data
Right 1114649228 14:24273029-24273051 TTTCTGGTGGAGCCTTTATGAGG No data
1114649224_1114649231 10 Left 1114649224 14:24273006-24273028 CCTGTGCCTACTGCAAAGAAGGT No data
Right 1114649231 14:24273039-24273061 AGCCTTTATGAGGTTCAGGGTGG No data
1114649224_1114649230 7 Left 1114649224 14:24273006-24273028 CCTGTGCCTACTGCAAAGAAGGT No data
Right 1114649230 14:24273036-24273058 TGGAGCCTTTATGAGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649224 Original CRISPR ACCTTCTTTGCAGTAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr