ID: 1114649228

View in Genome Browser
Species Human (GRCh38)
Location 14:24273029-24273051
Sequence TTTCTGGTGGAGCCTTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649224_1114649228 0 Left 1114649224 14:24273006-24273028 CCTGTGCCTACTGCAAAGAAGGT No data
Right 1114649228 14:24273029-24273051 TTTCTGGTGGAGCCTTTATGAGG No data
1114649222_1114649228 1 Left 1114649222 14:24273005-24273027 CCCTGTGCCTACTGCAAAGAAGG No data
Right 1114649228 14:24273029-24273051 TTTCTGGTGGAGCCTTTATGAGG No data
1114649225_1114649228 -6 Left 1114649225 14:24273012-24273034 CCTACTGCAAAGAAGGTTTTCTG No data
Right 1114649228 14:24273029-24273051 TTTCTGGTGGAGCCTTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649228 Original CRISPR TTTCTGGTGGAGCCTTTATG AGG Intergenic
No off target data available for this crispr