ID: 1114649230

View in Genome Browser
Species Human (GRCh38)
Location 14:24273036-24273058
Sequence TGGAGCCTTTATGAGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649222_1114649230 8 Left 1114649222 14:24273005-24273027 CCCTGTGCCTACTGCAAAGAAGG No data
Right 1114649230 14:24273036-24273058 TGGAGCCTTTATGAGGTTCAGGG No data
1114649224_1114649230 7 Left 1114649224 14:24273006-24273028 CCTGTGCCTACTGCAAAGAAGGT No data
Right 1114649230 14:24273036-24273058 TGGAGCCTTTATGAGGTTCAGGG No data
1114649225_1114649230 1 Left 1114649225 14:24273012-24273034 CCTACTGCAAAGAAGGTTTTCTG No data
Right 1114649230 14:24273036-24273058 TGGAGCCTTTATGAGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649230 Original CRISPR TGGAGCCTTTATGAGGTTCA GGG Intergenic
No off target data available for this crispr