ID: 1114649879

View in Genome Browser
Species Human (GRCh38)
Location 14:24277781-24277803
Sequence CCAAGATTCCCAGAGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649879_1114649899 29 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649899 14:24277833-24277855 GAAGCGGGGCCAGCAAGGGGAGG No data
1114649879_1114649897 25 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649897 14:24277829-24277851 TGGGGAAGCGGGGCCAGCAAGGG No data
1114649879_1114649896 24 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649896 14:24277828-24277850 GTGGGGAAGCGGGGCCAGCAAGG No data
1114649879_1114649894 15 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649894 14:24277819-24277841 GCTGGCCTTGTGGGGAAGCGGGG No data
1114649879_1114649893 14 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649893 14:24277818-24277840 TGCTGGCCTTGTGGGGAAGCGGG No data
1114649879_1114649889 5 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649889 14:24277809-24277831 GGTGCTGGATGCTGGCCTTGTGG No data
1114649879_1114649898 26 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649898 14:24277830-24277852 GGGGAAGCGGGGCCAGCAAGGGG No data
1114649879_1114649887 -10 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649887 14:24277794-24277816 GGAATCTTGGGTGGGGGTGCTGG No data
1114649879_1114649890 6 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649890 14:24277810-24277832 GTGCTGGATGCTGGCCTTGTGGG No data
1114649879_1114649888 -3 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649888 14:24277801-24277823 TGGGTGGGGGTGCTGGATGCTGG No data
1114649879_1114649891 7 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649891 14:24277811-24277833 TGCTGGATGCTGGCCTTGTGGGG No data
1114649879_1114649892 13 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649892 14:24277817-24277839 ATGCTGGCCTTGTGGGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649879 Original CRISPR CCAAGATTCCCAGAGGTCTC TGG (reversed) Intergenic