ID: 1114649885

View in Genome Browser
Species Human (GRCh38)
Location 14:24277788-24277810
Sequence CCCCCACCCAAGATTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649885_1114649889 -2 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649889 14:24277809-24277831 GGTGCTGGATGCTGGCCTTGTGG No data
1114649885_1114649898 19 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649898 14:24277830-24277852 GGGGAAGCGGGGCCAGCAAGGGG No data
1114649885_1114649888 -10 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649888 14:24277801-24277823 TGGGTGGGGGTGCTGGATGCTGG No data
1114649885_1114649899 22 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649899 14:24277833-24277855 GAAGCGGGGCCAGCAAGGGGAGG No data
1114649885_1114649893 7 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649893 14:24277818-24277840 TGCTGGCCTTGTGGGGAAGCGGG No data
1114649885_1114649894 8 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649894 14:24277819-24277841 GCTGGCCTTGTGGGGAAGCGGGG No data
1114649885_1114649897 18 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649897 14:24277829-24277851 TGGGGAAGCGGGGCCAGCAAGGG No data
1114649885_1114649890 -1 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649890 14:24277810-24277832 GTGCTGGATGCTGGCCTTGTGGG No data
1114649885_1114649892 6 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649892 14:24277817-24277839 ATGCTGGCCTTGTGGGGAAGCGG No data
1114649885_1114649896 17 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649896 14:24277828-24277850 GTGGGGAAGCGGGGCCAGCAAGG No data
1114649885_1114649891 0 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649891 14:24277811-24277833 TGCTGGATGCTGGCCTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649885 Original CRISPR CCCCCACCCAAGATTCCCAG AGG (reversed) Intergenic