ID: 1114649888

View in Genome Browser
Species Human (GRCh38)
Location 14:24277801-24277823
Sequence TGGGTGGGGGTGCTGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649885_1114649888 -10 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649888 14:24277801-24277823 TGGGTGGGGGTGCTGGATGCTGG No data
1114649879_1114649888 -3 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649888 14:24277801-24277823 TGGGTGGGGGTGCTGGATGCTGG No data
1114649873_1114649888 30 Left 1114649873 14:24277748-24277770 CCAGGACTGTGGGAGGAGGGTGG No data
Right 1114649888 14:24277801-24277823 TGGGTGGGGGTGCTGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649888 Original CRISPR TGGGTGGGGGTGCTGGATGC TGG Intergenic