ID: 1114649898

View in Genome Browser
Species Human (GRCh38)
Location 14:24277830-24277852
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114649879_1114649898 26 Left 1114649879 14:24277781-24277803 CCAGAGACCTCTGGGAATCTTGG No data
Right 1114649898 14:24277830-24277852 GGGGAAGCGGGGCCAGCAAGGGG No data
1114649885_1114649898 19 Left 1114649885 14:24277788-24277810 CCTCTGGGAATCTTGGGTGGGGG No data
Right 1114649898 14:24277830-24277852 GGGGAAGCGGGGCCAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114649898 Original CRISPR GGGGAAGCGGGGCCAGCAAG GGG Intergenic