ID: 1114654259

View in Genome Browser
Species Human (GRCh38)
Location 14:24306587-24306609
Sequence TAGAGCCAACTGATGGATGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114654259_1114654262 10 Left 1114654259 14:24306587-24306609 CCAACATCCATCAGTTGGCTCTA 0: 1
1: 0
2: 0
3: 2
4: 113
Right 1114654262 14:24306620-24306642 GATGTCCCACTTTGACTTTCCGG 0: 1
1: 0
2: 2
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114654259 Original CRISPR TAGAGCCAACTGATGGATGT TGG (reversed) Exonic
901796528 1:11682628-11682650 TAGAGCAACCTGATCGAGGTGGG + Intronic
903654049 1:24938143-24938165 TAGAGCCAACTGCTAGATCCAGG + Intronic
904291314 1:29487831-29487853 TAGAGGAAACTGATGGAAGAAGG + Intergenic
904882818 1:33713650-33713672 TAGAGGCAGCTGTTGGAAGTTGG - Intronic
908223239 1:62029931-62029953 TAGAGGGAACTCATTGATGTTGG + Intronic
909979540 1:82082302-82082324 TTTAGGCAACTAATGGATGTTGG + Intergenic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
911451093 1:98062213-98062235 TAGAACCAACTCATGGAAGAAGG + Intergenic
911515546 1:98864319-98864341 TAGAGAAAACTGCTGGATATTGG - Intergenic
917019604 1:170571398-170571420 TACAGCACACTGATGGGTGTTGG - Intergenic
917796399 1:178535904-178535926 TGGAGTGAACTGATGGGTGTGGG + Intronic
923029197 1:230233853-230233875 GAGAGGCAAGTGAGGGATGTAGG + Intronic
923326744 1:232886779-232886801 TAGATCCAAAAGGTGGATGTGGG + Intergenic
924077379 1:240354283-240354305 TAGGGCCAACTGAAGAATGGAGG + Intronic
1065104967 10:22373771-22373793 TAGAGGCAAATGAGGTATGTGGG + Intronic
1065941979 10:30573209-30573231 TAGAGCCAAGAGTTGAATGTGGG + Intergenic
1071679550 10:87690987-87691009 TACATCCAACTGAGGGAGGTGGG + Intronic
1080617269 11:33955571-33955593 AAGAGCCAGCTGATGGAGGCAGG - Intergenic
1080979633 11:37385830-37385852 TAGAGAAAACTAATGGATATAGG - Intergenic
1080979763 11:37387387-37387409 TAGAGAAAACTGATGGATCTGGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1089425796 11:118373672-118373694 CAGTTCCACCTGATGGATGTTGG - Exonic
1090593376 11:128294859-128294881 CAGAGCCAGCTGATGAATGATGG + Intergenic
1093216293 12:16365693-16365715 CAGAGCCAACTCATGGGTTTCGG - Intronic
1098830224 12:75352228-75352250 TGCAGCTCACTGATGGATGTTGG - Intronic
1102807871 12:115797850-115797872 CAGAGCCAACTCATGTATTTTGG + Intergenic
1110104413 13:71653283-71653305 TAGAACCAGCTGATGTTTGTTGG - Intronic
1112194152 13:97208326-97208348 TAGTGCCAATTAATAGATGTAGG + Intergenic
1113287946 13:108873981-108874003 TAGAGTCAACAGATGTTTGTTGG - Intronic
1114654259 14:24306587-24306609 TAGAGCCAACTGATGGATGTTGG - Exonic
1122947963 14:105021791-105021813 GAGAGCCAAGTGCTGGAAGTTGG + Intergenic
1126354920 15:47784964-47784986 CAGAGCCAACTGAAATATGTTGG - Intergenic
1127293925 15:57593217-57593239 ATGAGCCAACTGATGGATTCTGG - Intronic
1128631181 15:69269132-69269154 TAGCTGCAACTGATTGATGTGGG - Exonic
1130665399 15:85865111-85865133 GAGAACCCACTGAAGGATGTAGG + Intergenic
1132537641 16:490942-490964 TGGAGGCAGCTGAGGGATGTGGG + Intronic
1132542988 16:520049-520071 TACAGCCAAGTGATGGCTGACGG + Intronic
1138818821 16:60234003-60234025 ATGAGCCAGCTGATGGATCTGGG + Intergenic
1142821897 17:2475750-2475772 TAGAGCAAACTGATGGAGTCTGG + Intronic
1151194513 17:72422015-72422037 CAGAGCCACCTGACGAATGTGGG - Intergenic
1155177270 18:23311960-23311982 TCCATCCCACTGATGGATGTTGG + Intronic
1156213375 18:34972003-34972025 TAGATGTCACTGATGGATGTGGG + Intergenic
1159041444 18:63326663-63326685 CAGAGCCATCTGAGGGATGAAGG + Intergenic
1159814144 18:73052536-73052558 CAGAGCCAAGTGATGGAAGCAGG - Intergenic
930023975 2:47018961-47018983 AAGTGCCTACTCATGGATGTGGG + Intronic
937382071 2:121387425-121387447 TGGAGTCAAATGATTGATGTTGG + Intronic
937761501 2:125609237-125609259 AGCAGCCAACAGATGGATGTTGG + Intergenic
939688312 2:145226809-145226831 TTGAGACAACTGATGGATCATGG + Intergenic
941062382 2:160862409-160862431 TAGTGCCAAATGGTAGATGTAGG + Intergenic
945809045 2:214525658-214525680 CAGATTCAACTGATGGATCTGGG - Intronic
948773519 2:240266558-240266580 TACAACCAACAGATGGTTGTAGG + Intergenic
948775414 2:240285855-240285877 TAGACCCATCTGATGGATACGGG - Intergenic
1170379673 20:15743296-15743318 TATAGCCAAGTGATAGATGAGGG - Intronic
1170881125 20:20297162-20297184 TACAGGCAACTGGTGGGTGTTGG - Intronic
1172191393 20:33063872-33063894 TAGAGAGAACTGATGGTTCTGGG - Intronic
1173198625 20:40937578-40937600 TTGAGTCAACTGTTGGATGGAGG + Intergenic
1174418667 20:50385074-50385096 GAGAGCCCACTAATGGATTTGGG - Intergenic
1175656360 20:60774544-60774566 TTGAGACAAATGCTGGATGTTGG - Intergenic
1177018937 21:15828447-15828469 TGGAGACAACTGACAGATGTGGG + Intronic
1177089034 21:16743050-16743072 TAAAGGCAACTGAATGATGTTGG - Intergenic
1178518594 21:33268309-33268331 GAGAACCAAGTGCTGGATGTGGG + Intronic
1184937799 22:47737758-47737780 TTAAGCCAAGTGATGGATTTTGG - Intergenic
951783689 3:26393600-26393622 TAGAGCCTGTTGAGGGATGTGGG + Intergenic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956197483 3:66667590-66667612 TAAAGCCAGCTGATGTTTGTTGG - Intergenic
969965453 4:10989626-10989648 TAGAACCAAAAGGTGGATGTAGG + Intergenic
971000888 4:22321297-22321319 TGGAGCCAACTACTGTATGTTGG - Intergenic
973732437 4:53835565-53835587 TACAGCACACTGATGGGTGTTGG - Intronic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
978288414 4:107107389-107107411 TATAGCACACTGATGGATCTTGG - Intronic
979758758 4:124374084-124374106 TAAAGAGAACAGATGGATGTAGG + Intergenic
980250330 4:130306782-130306804 AAGTGCAAAATGATGGATGTGGG + Intergenic
980753849 4:137130113-137130135 TAGAGACAATTCAAGGATGTTGG - Intergenic
989409789 5:41106232-41106254 AAGAGCCAAATGTTGAATGTTGG + Intergenic
992740091 5:79764994-79765016 TAGATCCCACTGGTGGATTTTGG + Intronic
994598825 5:101875583-101875605 TAGAGACTACTGTTGGATCTTGG + Intergenic
997050921 5:130378703-130378725 AAGAGCCATCTGACAGATGTGGG - Intergenic
997519328 5:134512531-134512553 TAGAGCCTTCTCATGGACGTTGG - Intergenic
1004128460 6:12897010-12897032 TGGATCCAAGTGATGGATTTAGG - Intronic
1005066237 6:21820570-21820592 TTGAGCCAATTGATGGGTGTAGG + Intergenic
1007486520 6:42184478-42184500 AAGAGCCAACTGAGGGGTGAGGG - Exonic
1008045739 6:46849588-46849610 CAGAGCCAAGTGAAGGATGCCGG - Intergenic
1008618782 6:53251562-53251584 TAGAGCCTCCTGATTGATTTTGG - Intergenic
1009645446 6:66395661-66395683 TAGGGGAAACTGATGGCTGTAGG + Intergenic
1009706028 6:67253102-67253124 TAGTGCCATCTGATAGAAGTGGG + Intergenic
1011235362 6:85211073-85211095 TACAGCACACTGATGGGTGTTGG + Intergenic
1012975135 6:105772565-105772587 TAGAGTCAAGTATTGGATGTAGG + Intergenic
1014276333 6:119394379-119394401 TAGAGGCTACAGCTGGATGTTGG - Intergenic
1019108262 6:169687732-169687754 CACAGCCAACTGTGGGATGTGGG - Intronic
1023782704 7:43672316-43672338 TAAAGCCTACTGATGGTGGTGGG - Intronic
1024773402 7:52753526-52753548 TAGAATCAACTTATGGATTTAGG - Intergenic
1025252319 7:57359892-57359914 GAGAGCCCACTAATGGATTTGGG + Intergenic
1025987869 7:66471565-66471587 TAGAGGAAAGTGATGAATGTTGG - Intergenic
1026412754 7:70142168-70142190 TAGGTGCTACTGATGGATGTGGG + Intronic
1030271437 7:107672921-107672943 TCTAGCCAGCAGATGGATGTAGG - Intronic
1030319944 7:108155640-108155662 TATAGCCTAGTGATGGATGCAGG - Intronic
1034515841 7:151578678-151578700 TAGAGCCAACCCAGTGATGTGGG + Intronic
1036406003 8:8455785-8455807 TAGATGCAGCTGATGGATGGCGG + Intergenic
1038041670 8:23728499-23728521 TGGTGCCAACTGAGGGCTGTGGG - Intergenic
1040415559 8:47191759-47191781 TACACCCCACTGAAGGATGTAGG + Intergenic
1043193523 8:77258459-77258481 GAGAGCTATCTGATGGTTGTCGG + Intergenic
1044747882 8:95388841-95388863 TAGAGCACACTGATGGTTCTGGG + Intergenic
1045752861 8:105507058-105507080 TAGAGAGAACAGATGGATCTAGG + Intronic
1047078908 8:121437347-121437369 TAGTGCCAAGTGATTGATGCTGG - Intergenic
1047673830 8:127178255-127178277 TAGACCAACCTGATGGTTGTTGG - Intergenic
1048442711 8:134471735-134471757 TAGAGCTGAGGGATGGATGTAGG + Intergenic
1050076206 9:1867782-1867804 TATAGCCAACTGATTGATAAAGG + Intergenic
1051568360 9:18526359-18526381 TACAGCACACTGATGGATCTTGG + Intronic
1051665170 9:19462145-19462167 TATAGACAACTGAGGGAGGTGGG - Intergenic
1053651834 9:40177120-40177142 CAGAGCCAAGTGAAGGATGCCGG + Intergenic
1055640342 9:78314613-78314635 TAGAGCCAAGTTATGGGTGCTGG + Intronic
1057408187 9:94792637-94792659 AAGAGCCAACTCTTGGAGGTCGG - Intronic
1058135840 9:101306680-101306702 TAGAACCATCTGAGGGGTGTGGG + Intronic
1060190721 9:121590710-121590732 CAGAGCCTATTGATGGAGGTGGG + Intronic
1061691629 9:132337218-132337240 TAAAGCTAACTGATGGATTATGG + Intronic
1187658093 X:21503958-21503980 TAGAGCCAACAAATTGATTTTGG + Intronic