ID: 1114654991

View in Genome Browser
Species Human (GRCh38)
Location 14:24310649-24310671
Sequence CTGTAGGCCCAGAAGGATGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114654977_1114654991 14 Left 1114654977 14:24310612-24310634 CCACCCCTGAACGCCCTCTGTGG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654975_1114654991 16 Left 1114654975 14:24310610-24310632 CCCCACCCCTGAACGCCCTCTGT 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654983_1114654991 0 Left 1114654983 14:24310626-24310648 CCTCTGTGGCGCCTTCCACCCAC 0: 1
1: 0
2: 2
3: 14
4: 205
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654980_1114654991 10 Left 1114654980 14:24310616-24310638 CCCTGAACGCCCTCTGTGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654979_1114654991 11 Left 1114654979 14:24310615-24310637 CCCCTGAACGCCCTCTGTGGCGC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654976_1114654991 15 Left 1114654976 14:24310611-24310633 CCCACCCCTGAACGCCCTCTGTG 0: 1
1: 0
2: 2
3: 26
4: 167
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654981_1114654991 9 Left 1114654981 14:24310617-24310639 CCTGAACGCCCTCTGTGGCGCCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181
1114654982_1114654991 1 Left 1114654982 14:24310625-24310647 CCCTCTGTGGCGCCTTCCACCCA 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG 0: 1
1: 0
2: 2
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114654991 Original CRISPR CTGTAGGCCCAGAAGGATGT CGG Exonic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
907456769 1:54581331-54581353 CTGTGGGCCCAGTAGCCTGTGGG + Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
911809808 1:102261444-102261466 CTGTAGGCCCAAAAGGAAAAGGG - Intergenic
912067651 1:105764507-105764529 CTGTACCCCCAGGAGGGTGTGGG - Intergenic
912397831 1:109360770-109360792 GGGTAGGCCCACAAGGATCTGGG + Intronic
915088087 1:153402134-153402156 CTGTAGGACCAGGAGGCTGCTGG + Intergenic
915442522 1:155954228-155954250 CTTTAATCCCAGAAGGATTTGGG - Intronic
919963511 1:202497031-202497053 CAGTAGGCACAGAAAAATGTAGG - Intronic
920198669 1:204245807-204245829 CTGCTGGCCCAAAGGGATGTGGG - Intronic
921240287 1:213173637-213173659 CTGTGGTCTCAGAAAGATGTGGG - Intronic
921827598 1:219691260-219691282 CTGTAATCCCAGAAGGTTGGAGG + Intronic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
924607991 1:245551699-245551721 CCGGAAGCCCAGAAGGAAGTTGG + Intronic
1064137284 10:12761970-12761992 CCGTTGGCACAGAAGGATCTGGG + Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1069442563 10:68442035-68442057 CTGTAGTCCCAGGATGAGGTGGG - Intronic
1070319960 10:75347362-75347384 CTGCGGGCCCAGATGGATGTGGG - Intergenic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1072215577 10:93284809-93284831 CTGTAGGGCCTGAAGGTTGTGGG + Intergenic
1072552940 10:96493182-96493204 CTGTAGGCACAGAGAGATTTAGG + Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076304464 10:129454771-129454793 CTTGAGCCCAAGAAGGATGTGGG - Intergenic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1077968985 11:7167559-7167581 AGGCAGGCCCAGAAGGATGGGGG + Intergenic
1081446936 11:43139824-43139846 AAGGAGGCCAAGAAGGATGTTGG - Intergenic
1082073946 11:47961951-47961973 CTGTAGGCCTAGAAGGACCTGGG - Intergenic
1083169740 11:60915968-60915990 CTGTAAGCCCAGAAGGCAGATGG + Intronic
1083336510 11:61924798-61924820 CTTTGGGCCCAGATGGGTGTGGG + Intergenic
1085276284 11:75302242-75302264 CTGTCGGCCTAGAAGTCTGTGGG - Intronic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1090024087 11:123152931-123152953 CTGGAGGGAGAGAAGGATGTTGG + Intronic
1093027267 12:14256289-14256311 CAGTACGCTCAGAAGGATGTGGG - Intergenic
1093670778 12:21872693-21872715 TTGTGGGCCAAGTAGGATGTGGG - Exonic
1094800376 12:34026260-34026282 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095113165 12:38320558-38320580 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095985007 12:47993656-47993678 CTGTTGGCCCATCAGGATGTAGG + Intronic
1096843050 12:54390800-54390822 TCCTGGGCCCAGAAGGATGTCGG + Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102982437 12:117252651-117252673 GTGTAGGGACAGGAGGATGTGGG + Intronic
1103627483 12:122231082-122231104 CTGTGGGACCAGTTGGATGTTGG + Exonic
1103665281 12:122559231-122559253 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
1104433172 12:128733161-128733183 ATGTAGGTCCAGTTGGATGTGGG + Intergenic
1104465009 12:128983253-128983275 CTGAACGCACAGAAGGATATGGG - Exonic
1104694257 12:130851752-130851774 CTGAGGCCCCAGAAGGATCTGGG - Intergenic
1107201486 13:37724254-37724276 GTGTAGGCCCATAAGTGTGTAGG + Intronic
1112227883 13:97558280-97558302 CTGCAGGCTCAGAAGGCTGGAGG + Intergenic
1113335577 13:109373057-109373079 CTGTAGGCTCAGAGGGTTGGAGG + Intergenic
1113944071 13:114033845-114033867 CTGAGGGGCCACAAGGATGTTGG + Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114353920 14:21886538-21886560 CTGGAGGCCATGAAGGATGCAGG - Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1114686703 14:24539044-24539066 CTGTGGTCCAAGAAGGTTGTTGG - Intergenic
1115051251 14:29066351-29066373 CTAAAGGCTGAGAAGGATGTTGG - Intergenic
1115571465 14:34670667-34670689 CTTTAGGCCTGGAAGGATGATGG - Intergenic
1117770045 14:59124930-59124952 GTGTAGGGCCTGAAGGATCTAGG - Intergenic
1122393646 14:101407591-101407613 CGGGAAGCCCATAAGGATGTGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124577386 15:30921869-30921891 CTGTGTTCCCAGAAGTATGTGGG + Intronic
1124862345 15:33454611-33454633 ATGTAGTCCCAGAAGTATGCAGG + Intronic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1125757032 15:42071169-42071191 CTGGAGGCCCTGGAGGAAGTTGG + Exonic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1129419513 15:75412825-75412847 CTGAAGGCTGGGAAGGATGTTGG + Exonic
1130689962 15:86073569-86073591 CCATAGGTCCTGAAGGATGTGGG + Intergenic
1131211405 15:90500120-90500142 CTGCCAGCCCAGAAGGATGAAGG + Exonic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131575123 15:93581797-93581819 CTGTTGGCCAAGCAGGATATTGG + Intergenic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1134833580 16:17343421-17343443 CTTGAGGCACAAAAGGATGTAGG - Intronic
1138160684 16:54750448-54750470 CATTAGTCCAAGAAGGATGTGGG + Intergenic
1139434879 16:66930739-66930761 CTGTAATCCCAGCAGGTTGTGGG + Intergenic
1139515756 16:67451449-67451471 CTGGAGGGCCTGAAGGCTGTGGG + Intronic
1142031403 16:87840281-87840303 CTCTGGGGCCAGCAGGATGTGGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143188553 17:5024653-5024675 CTGGAGTCCCATGAGGATGTGGG + Exonic
1144409940 17:14991155-14991177 CTGGAGGCCCAAGGGGATGTGGG + Intergenic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146575371 17:33986493-33986515 GAATAGGCCCAGAAGGATTTAGG - Intronic
1147869662 17:43578426-43578448 CAGTTGGCCCAGAAGGGTGTTGG + Intronic
1149052163 17:52318637-52318659 ATGAAGCCCCAGAATGATGTGGG + Intergenic
1149324886 17:55519877-55519899 TTGTAGGTCCTGAAGTATGTGGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1153378786 18:4412280-4412302 GTTTAGGCCCAGGAGGTTGTGGG - Intronic
1154171464 18:12056157-12056179 CTGGAGTCCCAAGAGGATGTGGG - Intergenic
1157551000 18:48581958-48581980 GAGTAGACCCAGAAGGATGATGG + Intronic
1160005577 18:75066641-75066663 TTCTAGGCCCAGAAGGATTGCGG + Intergenic
1160979422 19:1810101-1810123 CTGCATGCCCAGAAAGATCTGGG - Intronic
1161085341 19:2332636-2332658 CTGCAGCCCCAGAAGGCTGAGGG + Intronic
1163489784 19:17610348-17610370 CTTTAGCCCCACAAGTATGTGGG - Intronic
1168045445 19:53790955-53790977 CTGTATGGCCAGCAGGGTGTAGG + Intergenic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
926019519 2:9482963-9482985 CTGCAGGCCCAGAAGCAAGCTGG - Intronic
926763580 2:16302705-16302727 GTGTAGCCCCAGAAGGCTGATGG - Intergenic
929517229 2:42614850-42614872 CTGTATTCCCAGAAGTATTTGGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
931381017 2:61753354-61753376 CTGTTAGCCCAGAATGATTTGGG + Intergenic
932585744 2:73027235-73027257 ATGTAGGCCTAGAATGATATGGG + Intronic
933186142 2:79281048-79281070 GTGAAGCCCCATAAGGATGTGGG - Intronic
933664721 2:84955718-84955740 CTGTAGGGCCAGAAAGATGTTGG + Intergenic
935070016 2:99685927-99685949 CTGTAATCCCAGTAGGCTGTGGG + Intronic
936558287 2:113514746-113514768 AAGGAGGCCGAGAAGGATGTCGG + Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938795289 2:134713708-134713730 CTGAAGGCCCAGCTGAATGTGGG - Intronic
939538050 2:143457421-143457443 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
942458781 2:176155580-176155602 CTGTGGGCCCAAATGGATGCTGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
946136298 2:217650360-217650382 CTGTGTGCCCAGGAAGATGTGGG - Intronic
947460104 2:230296694-230296716 CTGTGGTCCCAGGAGGCTGTGGG + Intronic
948219675 2:236259682-236259704 CAGTGAGCCCAGCAGGATGTTGG + Intronic
1169803175 20:9532384-9532406 CTGTGGGCACAAGAGGATGTTGG + Intergenic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170577123 20:17672635-17672657 TTGCAGGACCAGAAGGAGGTAGG - Intronic
1171970904 20:31564452-31564474 CTGTAGGCCCAGCAACTTGTAGG + Intronic
1175030548 20:55949621-55949643 CTGTAGGCTCACTAGAATGTAGG + Intergenic
1175169122 20:57067612-57067634 CTGGAGACCCAGGAGGATCTGGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1179055110 21:37924518-37924540 CAGAAGTCCCAGCAGGATGTGGG + Intergenic
1179109381 21:38433280-38433302 CTGCAGGCCCAAAAAGATGGAGG + Intronic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181433519 22:22896960-22896982 CTGCAGGAGCAGGAGGATGTGGG + Intergenic
1184804517 22:46784686-46784708 CAGTAGGCCAAGAAGCATGCTGG + Intronic
950579252 3:13852046-13852068 GTCTAAGCCCAGCAGGATGTGGG - Intronic
953462842 3:43095361-43095383 CTGTAAGCCCAGAGGGCAGTGGG - Intronic
953692353 3:45130498-45130520 GTGTATGTCCAGAAGGATGGCGG - Intronic
953774551 3:45804092-45804114 CTGAAGGCCCAGGAGGGAGTGGG - Intergenic
954118090 3:48478311-48478333 CTGTAGGCCCAGGCAGGTGTGGG - Intronic
954839576 3:53498595-53498617 CACCAGGCCCAGAAGGATGGAGG + Intronic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959869935 3:111314725-111314747 CTGTGGGCCAGCAAGGATGTAGG + Intronic
961829823 3:129617743-129617765 CTGTGGAGCCAGAAGGATCTGGG + Intergenic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
966937367 3:184719809-184719831 CTGTTGGGCCAGAAGGTGGTTGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
969597489 4:8157585-8157607 CTGTAGGCCTAGAAGGGGGCGGG - Intronic
971325153 4:25637477-25637499 TTGTAGGTCCAGAAGGAAGCAGG - Intergenic
971449607 4:26787717-26787739 CTGAAGGTTCAGAAGGAAGTAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
974118678 4:57611810-57611832 CTGTAGTCCCAGGGGGATGAGGG + Intergenic
975576482 4:75868191-75868213 CTGTAGTCCCAGATGCTTGTGGG + Intronic
976733075 4:88283930-88283952 CGGTACGCCCAGAGGGAGGTTGG - Intronic
977035695 4:91950206-91950228 CTGTAGCCCCAGCACGAGGTAGG + Intergenic
979175934 4:117664055-117664077 CTGTAGTCCCAGAATGGAGTGGG + Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
983413281 4:167424626-167424648 CTTTAGCCGCAGGAGGATGTTGG + Intergenic
984142450 4:176020283-176020305 CTGTATGCCCCAAAGGATATGGG + Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990453611 5:55961373-55961395 CTCTAGGCCCAAAGGGATGAGGG + Intronic
1000597454 5:163232272-163232294 CTATAGGCCCAGAAGGTTCACGG + Intergenic
1001364269 5:171121521-171121543 CTGCTGGCCCAGTAGCATGTTGG + Intronic
1001565356 5:172696337-172696359 CGGGAGGCCCAGGAGGTTGTAGG - Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1007247159 6:40470992-40471014 CAGCAGGCTGAGAAGGATGTTGG + Intronic
1007668651 6:43533021-43533043 CTGTAGTCCCAGCAGGCTGTGGG + Intronic
1007796052 6:44348587-44348609 CTGTGGGCCCAGCAGCAGGTAGG + Intronic
1011706804 6:90008761-90008783 ATTGAGGCCCAGGAGGATGTTGG + Exonic
1016992881 6:149942092-149942114 CGGGAGGCACAGAAGGATCTTGG - Exonic
1017305651 6:152915111-152915133 CTGCAGGGCCAGGAGGATGTGGG + Intergenic
1020183354 7:5939763-5939785 CTGTAGGCCGAAAAGCACGTCGG + Intronic
1020299558 7:6784995-6785017 CTGTAGGCCGAAAAGCACGTCGG - Intronic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026522861 7:71131962-71131984 CTGAAGGCCCCGAAGGCTCTCGG + Intergenic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1031837897 7:126701210-126701232 CTGCAGGCCCGGAAGGTTGGGGG + Intronic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1034892808 7:154855543-154855565 CGGTATCCCCGGAAGGATGTTGG + Intronic
1042229833 8:66544351-66544373 GTGTAGGCCCAGCGGGAAGTGGG + Intergenic
1044373709 8:91445092-91445114 CTTTAGTCCAAGAAGGATTTAGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1049212351 8:141392503-141392525 CTGGAGGCACGGAAGGCTGTGGG - Intronic
1049894574 9:101520-101542 AAGGAGGCCGAGAAGGATGTGGG - Intergenic
1050030221 9:1378236-1378258 CTGCAGGCCCAGAAGGCTCAGGG - Intergenic
1051522458 9:18004450-18004472 GTGAAGGCACAGAATGATGTGGG + Intergenic
1052684169 9:31733190-31733212 CTGGGTGCCCAGAAGTATGTTGG + Intergenic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053269499 9:36740334-36740356 CTGGAGGACAAGAAGGATTTGGG - Intergenic
1053735781 9:41101510-41101532 AAGGAGGCCGAGAAGGATGTGGG - Intergenic
1054692595 9:68329888-68329910 AAGGAGGCCGAGAAGGATGTGGG + Intronic
1055956961 9:81783016-81783038 CTATAATCCCAGAAGGATTTTGG - Intergenic
1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG + Intergenic
1056547266 9:87623165-87623187 CAGCAGGCCCAGGAGGATGTGGG - Intronic
1057090328 9:92252164-92252186 CTGTAGGACCCGAAGGCTGAAGG + Intronic
1057227219 9:93298705-93298727 CTGTGTGCCCTGAAGGTTGTGGG - Intronic
1057632699 9:96733718-96733740 CTGTAGGTCCAGAATGATTCTGG - Intergenic
1057915413 9:99051693-99051715 CCGTAAGCACAGAAGGATTTTGG + Intronic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1059351178 9:113666029-113666051 CTGTAGACCCCCAAGCATGTGGG + Intergenic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1185650195 X:1642060-1642082 CTGATGGCCCATGAGGATGTGGG + Intronic
1185650270 X:1642476-1642498 CTGATGGCCCATGAGGATGTGGG + Intronic
1186965601 X:14783403-14783425 CTGCAGGCCCAGAAGGCTGTGGG - Intergenic
1192040027 X:67609969-67609991 CTAGAGGCCAAGAAGGAGGTAGG + Intronic
1194603241 X:95949468-95949490 CTGGAGTCCAAGAGGGATGTAGG - Intergenic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1197245418 X:124161754-124161776 CTGTAGGTCCAGAAGCAAATAGG + Intronic
1200088448 X:153623347-153623369 CTCTGGGGCCCGAAGGATGTAGG - Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic