ID: 1114655202

View in Genome Browser
Species Human (GRCh38)
Location 14:24311589-24311611
Sequence GAAGGCTCTGGGGAGGCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 393}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114655195_1114655202 -1 Left 1114655195 14:24311567-24311589 CCGTTTCCTCACGCGGCTCTTCG 0: 1
1: 0
2: 0
3: 11
4: 63
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655193_1114655202 1 Left 1114655193 14:24311565-24311587 CCCCGTTTCCTCACGCGGCTCTT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655191_1114655202 11 Left 1114655191 14:24311555-24311577 CCGGGCAGGTCCCCGTTTCCTCA 0: 1
1: 0
2: 0
3: 18
4: 213
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655189_1114655202 13 Left 1114655189 14:24311553-24311575 CCCCGGGCAGGTCCCCGTTTCCT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655197_1114655202 -7 Left 1114655197 14:24311573-24311595 CCTCACGCGGCTCTTCGAAGGCT 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655194_1114655202 0 Left 1114655194 14:24311566-24311588 CCCGTTTCCTCACGCGGCTCTTC 0: 1
1: 0
2: 1
3: 5
4: 160
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655185_1114655202 30 Left 1114655185 14:24311536-24311558 CCGCTGGAGATCTGCTGCCCCGG 0: 1
1: 0
2: 2
3: 49
4: 276
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393
1114655190_1114655202 12 Left 1114655190 14:24311554-24311576 CCCGGGCAGGTCCCCGTTTCCTC 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG 0: 1
1: 0
2: 3
3: 37
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114655202 Original CRISPR GAAGGCTCTGGGGAGGCCCG AGG Exonic
900413568 1:2524875-2524897 GGAGCCTCTGGTGAGGCCTGCGG + Intronic
900655297 1:3753931-3753953 CAGGTCTCTGGGGAGGCCTGAGG + Intronic
900693962 1:3998919-3998941 GAGGGAACTGGGGAGCCCCGGGG + Intergenic
900936451 1:5769169-5769191 CCAGGCTGTGGGGAGGGCCGGGG - Intergenic
900972747 1:6000530-6000552 GATGGGTCTGGGGAGGCCACTGG + Intronic
901045337 1:6392884-6392906 GGATGCTCGGGCGAGGCCCGAGG + Intronic
901130687 1:6961298-6961320 AAGGGCTTTGGGGAGGCCAGAGG + Intronic
901301015 1:8200262-8200284 GAAGGCTCCGGGGAGACGCAGGG - Intergenic
901677724 1:10896796-10896818 AAAGGCTCTGAGAAGGCCTGTGG - Intergenic
901764807 1:11492927-11492949 GAAGACTCTGGGAGGGCCCTAGG + Intronic
902089123 1:13888975-13888997 GAAGGTTCTGCAGAGCCCCGGGG - Intergenic
902323537 1:15684193-15684215 GGGGTCTCTGGGGAGGGCCGCGG + Intergenic
902594365 1:17498201-17498223 GAAGGTTCTGCAGAGCCCCGGGG + Intergenic
902631155 1:17705504-17705526 GGAGGCCCTGGGGAGGGCTGGGG + Intergenic
903041461 1:20533696-20533718 GAAGGTTCTGCAGAGCCCCGGGG + Intergenic
903290925 1:22313760-22313782 AGAGGCTCTGGGGAGGTCAGGGG + Intergenic
903364291 1:22796363-22796385 GAAGAGACTGGGAAGGCCCGAGG - Intronic
904697294 1:32337487-32337509 GAAGCCTCCTGGGAGGCCTGAGG + Intergenic
905862746 1:41361839-41361861 GCACGCCCCGGGGAGGCCCGCGG - Intergenic
906276871 1:44523305-44523327 GAAGGGTCTGGGCAGGCCCCAGG + Intronic
906651381 1:47515469-47515491 GCAGGCTCTGCTGAGGCCTGAGG + Intergenic
907924654 1:58944178-58944200 GAAGGCACTGAGGAGGACCATGG + Intergenic
909363936 1:74798211-74798233 GAAGTCTCTGGGGAGGCCTCAGG + Intergenic
910292043 1:85608644-85608666 TAAGGCTCTGGGGACCCCAGGGG + Intergenic
910430175 1:87152229-87152251 GAAACCTCTGGGGAGGCCGGCGG - Intronic
911096140 1:94056588-94056610 GAAGGCTGTGGTGAGGCCCTTGG - Exonic
913069685 1:115287254-115287276 GAATCCTCTGGGAAGGCACGGGG + Intronic
914218444 1:145655846-145655868 GAAGGGTCTGGGCAGTCCAGAGG - Intronic
914471003 1:147978537-147978559 GAAGGGTCTGGGCAGTCCAGAGG - Intronic
915558632 1:156674099-156674121 GAAGGGTCTGGTGGGCCCCGAGG - Intronic
915690160 1:157680937-157680959 GAAGGCTCTAGGGAGGAGCCAGG - Intronic
915765031 1:158354101-158354123 GGAAGCTCTGGGGAGGTCCTGGG + Intronic
916132143 1:161620403-161620425 GGAGGCTATGGAGAGGCCCTGGG + Intronic
916786909 1:168093006-168093028 GAAGGTTCTGGGTCGGCCAGCGG + Intronic
917711055 1:177685731-177685753 GAGGAGTCTGGGGAGGCCAGTGG - Intergenic
919756449 1:201069108-201069130 GAAGGCTGTGGGGCAGCCCTGGG - Intronic
920506396 1:206518301-206518323 GAGGGCTCCGGGGAGGGCCCTGG - Intronic
921099837 1:211919361-211919383 GAAAGCTCTGGGGTAGCTCGAGG - Intergenic
922780753 1:228250476-228250498 GAAGGCTCTGGGCAGGTGCTAGG - Intronic
922886919 1:229027467-229027489 AAAGGCTGTGGGGAGGTGCGAGG - Intergenic
1062861957 10:817098-817120 GAAGGCTCTGGGAAGTACAGAGG - Intronic
1063606698 10:7528761-7528783 GAAGGCTCTGGAAATGCCCCCGG + Intergenic
1065020113 10:21496255-21496277 GACGGCACTGGGGAGGGCTGGGG - Intronic
1067321187 10:45222711-45222733 GTAGGCTCCGAGGAGTCCCGAGG + Intergenic
1067554064 10:47255561-47255583 GACGGCTCTGGGGAGCCTCTAGG + Intergenic
1069535221 10:69248220-69248242 GAAGGCACTTGGGAGGCTCGGGG - Intronic
1069840544 10:71336868-71336890 GAAGGCTGGGGAGAGCCCCGGGG + Intronic
1069901344 10:71708286-71708308 GAGGGCTCTGGGCAGGTCAGCGG - Intronic
1069903662 10:71719981-71720003 GAAGACTCTGGGGAGACGCAGGG + Intronic
1069907539 10:71740634-71740656 GAAGGCTTTGGGGAGAGCCCAGG + Intronic
1070776832 10:79114693-79114715 GATGGCTCTGGGGGGCCCAGGGG + Intronic
1070889442 10:79931045-79931067 AAAGGGTCTGGGGAGTCCAGAGG + Intergenic
1071204800 10:83261965-83261987 GAAGGCTATGGGCAGGCTAGGGG - Intergenic
1072257132 10:93631149-93631171 CAAGGCCCCGGGGAGGCCCCAGG - Intronic
1072752731 10:97994847-97994869 GAAGGTCCTGTGGAGGCCCAAGG + Intronic
1073082750 10:100870289-100870311 GAAGACCCTGGGGAGGGCTGTGG - Intergenic
1074109575 10:110412955-110412977 AAGGCCTCTAGGGAGGCCCGAGG - Intergenic
1075003971 10:118817527-118817549 TAGTGCTTTGGGGAGGCCCGGGG - Intergenic
1075086228 10:119416030-119416052 GGTGGCTCTGGGGAGGCCTCTGG + Intronic
1075568367 10:123520791-123520813 GAAGGCACTCGGGAAGACCGGGG - Intergenic
1075802436 10:125161271-125161293 GGAGGCCCTCGGGAGGCGCGGGG + Intergenic
1076109422 10:127849489-127849511 GAAGGCCCTGGGGGAGACCGAGG + Intergenic
1076250379 10:128979903-128979925 GAAGGGGCAGGGGATGCCCGGGG + Intergenic
1076361792 10:129894728-129894750 ATAGGCTCTGTGGAGGCCCCAGG - Intronic
1076467738 10:130696738-130696760 GCTGCCTCTGGGGAGGCCCGTGG + Intergenic
1076494032 10:130885228-130885250 GAAGGCTTTGGGGGGGCCTCTGG + Intergenic
1076539722 10:131206416-131206438 GAAGGCTCAGGTGAGGCAGGTGG - Intronic
1076563375 10:131381823-131381845 GTGGGCCCTGGGGAGGCCTGGGG - Intergenic
1077112720 11:869035-869057 CCAGGCTCTGGGGAGGCCCTGGG - Exonic
1077274881 11:1699990-1700012 GCAGGCCCTGGGGAGGACCTTGG + Intergenic
1077295121 11:1822930-1822952 GAGGGCTCAGGGCAGGCCCTAGG - Intergenic
1077317454 11:1925772-1925794 GAAGGCTGTGAGGGGGCCTGGGG - Intronic
1077342658 11:2032974-2032996 GCAGGCTCCGGGGAGCTCCGAGG - Intergenic
1077370515 11:2179664-2179686 GAAGGCCCTGGCGAGGCCGTGGG - Intergenic
1077394541 11:2314668-2314690 CAAGGGTCTGGGGAGGCCAAGGG - Intronic
1077405398 11:2380242-2380264 GTGGGCTCTGGGGAGGCTGGTGG + Intronic
1079158636 11:17972833-17972855 GATGGCTTTTGGGAGGCCCAAGG + Intronic
1081549120 11:44095961-44095983 GGAGGCTCCGTGGAGGCCCGTGG + Intronic
1081914215 11:46720392-46720414 GCAGGCTCTGGGGAGGTTTGTGG - Intronic
1082002337 11:47400144-47400166 GGGCGCTCTGGGGAGGCCGGGGG + Intergenic
1083654105 11:64220726-64220748 GAAGGCTCTGTGGAGACCCAGGG - Intronic
1083960620 11:66012973-66012995 TGAGGCTCTGGGGAGGGCTGGGG - Intronic
1084477857 11:69398982-69399004 GCAGGATGTGGGGGGGCCCGGGG + Intergenic
1084709396 11:70834806-70834828 GCAGGATCGAGGGAGGCCCGTGG + Intronic
1084889798 11:72231036-72231058 GAAGGGTCTGGGGAAGACCCTGG + Exonic
1085066362 11:73499039-73499061 GAAGGGTCTTGGGTGGCACGGGG - Intronic
1086139158 11:83475144-83475166 GAAGCCTGTGGGGAAACCCGTGG + Intronic
1088910823 11:114190929-114190951 TCAGGCTCTGGGGAGGCCTCAGG + Intronic
1089646860 11:119886282-119886304 GAGGTCTCTGGGGAGGGCTGGGG - Intergenic
1090028469 11:123187217-123187239 GCAGGGTCTGGGGAGCCCAGGGG + Intronic
1090446944 11:126772695-126772717 GAAAGCTCTGGAGAGGCCACAGG + Intronic
1091240511 11:134049143-134049165 GAAGGATCTGTGGAGTCCCAGGG + Intergenic
1202825644 11_KI270721v1_random:88163-88185 GCAGGCTCCGGGGAGCTCCGAGG - Intergenic
1097694705 12:62764957-62764979 ACAGGCTCAGGGGAGGCTCGAGG + Intronic
1100391233 12:94148089-94148111 GGAGGCCCCGGGGAGGCGCGCGG - Intergenic
1101246120 12:102885683-102885705 GCAGGCTCTGGCCAGGCCTGGGG - Intronic
1102508968 12:113401735-113401757 GAAGCAGCTGGGGTGGCCCGGGG + Intronic
1102997260 12:117360457-117360479 GGAGGCTCTAGGGAGGCCGAGGG - Intronic
1104242710 12:127006170-127006192 GAAGGCACTGGGGAGGTGCCGGG - Intergenic
1104458212 12:128932765-128932787 GAAGGCTCTGGGCACGACCCTGG + Intronic
1104727212 12:131085404-131085426 CAAGGCCCTGGGGAGGCGGGAGG + Intronic
1104848324 12:131858269-131858291 GGGTGCTCTGGGGAGGCCCTGGG + Intergenic
1104848340 12:131858323-131858345 GAATGCTCTGGGGAGGCCCTGGG + Intergenic
1104918378 12:132278079-132278101 GCGGGCTCTGGGGAAGCCCCGGG + Intronic
1104975143 12:132548840-132548862 GACGGCCCTGCAGAGGCCCGAGG + Intronic
1106492648 13:30241645-30241667 TAAAGCTCTGGGGAGGCACTTGG - Intronic
1110786774 13:79537952-79537974 GCAGCTTCTGGGGAGGCCCCAGG + Intronic
1113231213 13:108215562-108215584 GCAGGCGCAGGGGAGACCCGGGG + Intronic
1113378965 13:109786198-109786220 GGAAGGTCCGGGGAGGCCCGCGG + Exonic
1113572094 13:111365407-111365429 CAAGACTCTGGGGAGGCTGGGGG + Intergenic
1113834052 13:113317209-113317231 GGAGCCTCTGGGGAGACCTGAGG - Intronic
1113931818 13:113972766-113972788 GAAGGCCCTGGTGAGGGCCTGGG - Intergenic
1114182177 14:20376404-20376426 CAAGGCTGTGGAGAGGCCCTGGG + Intronic
1114655202 14:24311589-24311611 GAAGGCTCTGGGGAGGCCCGAGG + Exonic
1117334292 14:54743727-54743749 GAGGCCTCTGGGGAGGCTCCAGG - Intronic
1119145578 14:72310752-72310774 GAAGGCTCAGGGGAGGCTGGTGG - Intronic
1120405161 14:84084975-84084997 CATGGCTCTGGGGAGGCCTCAGG + Intergenic
1121120715 14:91374130-91374152 GAAGGCTCTGGTGAGAACAGAGG + Intronic
1121324980 14:93014567-93014589 TGAGGCTGTGGGGAGGCACGCGG + Intronic
1121880535 14:97496800-97496822 GAGGGCCCTCGGCAGGCCCGTGG + Intergenic
1122186108 14:99997533-99997555 GAAAGGTATGGGGAGGGCCGTGG + Intronic
1122352579 14:101104556-101104578 GTGGGCTCTGTGGGGGCCCGGGG - Intergenic
1122785286 14:104160639-104160661 GAAGGCTCTGGTGACCCCCAGGG + Intronic
1122802613 14:104239204-104239226 TTAGGCTCTGGGGAGGCCATGGG + Intergenic
1122862699 14:104589617-104589639 GTAGGGTCTGGAGAGGCCCCTGG - Intronic
1123025139 14:105420529-105420551 GAGGGCTCTAGGGAGGAACGTGG - Intronic
1124142314 15:27088334-27088356 CAGGGCTCTGGGGAAGCCCCAGG + Intronic
1124347913 15:28934682-28934704 TATGGCTCTGAGGAGGCCCCAGG - Intronic
1124694048 15:31848574-31848596 AAAGGCTTTGGGAAGGCCGGAGG - Intronic
1125676988 15:41507395-41507417 GAAGGAGCTGGGGAGGCCTGGGG - Intronic
1128373990 15:67062819-67062841 GAAAGCTCTGAGGAGGGCTGAGG - Intergenic
1129705234 15:77790595-77790617 CAATGCCCTGGGGAGGCCCCAGG + Intronic
1130064803 15:80594704-80594726 GCAGGCTCTGGGCAGGCACAAGG - Exonic
1130117804 15:81020590-81020612 GAAGGCAGTGGGGTGGCCCAGGG + Intronic
1130954782 15:88620019-88620041 GAAGGCTTTGGGGAGGCAGAGGG - Intergenic
1132550648 16:552628-552650 GGCGGCTCTGGGGAGGCTCTCGG - Exonic
1132584075 16:698503-698525 GAAGGGTCTGGGGTGGCCTCTGG + Intronic
1132638823 16:967677-967699 GACGGCTCCTGGGAGGACCGAGG - Intronic
1132676497 16:1123375-1123397 GAAGGCGCGCGGGAGGCCGGAGG - Intergenic
1132695411 16:1199698-1199720 GAAGGCTGAGGGGAGACTCGGGG - Intronic
1132709478 16:1260030-1260052 GGAGGGTCTGGGGAGGCTCCTGG - Intergenic
1133019474 16:2960864-2960886 GAGGCCGCTGGGGAGGCCCTGGG - Intergenic
1133223492 16:4328995-4329017 AGAGGCTGTGGGGAGGCCTGTGG + Intronic
1133240688 16:4412524-4412546 AGAGGCTCTGGGAAGGTCCGAGG - Intronic
1135956241 16:26958847-26958869 GATGGCTCTGGGAAGGCTTGGGG - Intergenic
1136346800 16:29680974-29680996 GAAGGTTGTGGGGAGGACAGAGG + Intronic
1136499397 16:30662559-30662581 GAAGGCGCCGTGGGGGCCCGAGG - Exonic
1137531407 16:49281098-49281120 AAGGGCTCTGCGGAGGCGCGGGG - Intronic
1139478181 16:67213615-67213637 GAAGGCTCTGGCAATGCCCCAGG + Intronic
1139512973 16:67437777-67437799 GAAGCAACTGGGGAGGCCAGGGG + Intergenic
1139588531 16:67919838-67919860 CAGGGCTCTGGGGAGCCCAGTGG - Intronic
1139952623 16:70679546-70679568 GAAGGCTTTGGGGCGCCCCACGG + Intronic
1140044968 16:71434379-71434401 GAAGGCCCTGGAGAGACCCAGGG + Intergenic
1141612054 16:85187372-85187394 CAAGGCCCTGGGGAGCACCGGGG + Intergenic
1141821791 16:86451190-86451212 GAAAGCTCTGGGGGGACCCTGGG - Intergenic
1141893383 16:86942848-86942870 GAAGACTATGGCGAGGCCCGGGG + Intergenic
1142352132 16:89585425-89585447 GCTGGCTCAGGGGAGGCCCAGGG - Intronic
1142356765 16:89605041-89605063 GAAGGCTCTGCGGAGGCCCCAGG + Intergenic
1142590895 17:1005516-1005538 GAAAGCTCTGAAGAGGCCCTGGG - Exonic
1143164463 17:4891038-4891060 GGGGGCCCTGGGGAGGCCTGGGG - Exonic
1143498789 17:7327140-7327162 GAGGGCTTTGGGGAGGCCCTGGG - Intronic
1143582542 17:7835341-7835363 GAAGACTGTGGGGAAGGCCGAGG + Intergenic
1143651968 17:8268869-8268891 GAAGGCTGGGGGAGGGCCCGAGG + Intronic
1145012755 17:19378934-19378956 GACGGCTCTGCGGAGCCCCCCGG + Exonic
1146062175 17:29613260-29613282 GGAGGCTCCAGGGCGGCCCGCGG - Intronic
1146179656 17:30689453-30689475 GAAGCATCTGGAGGGGCCCGCGG - Intergenic
1146626633 17:34440081-34440103 AAAGGCAGTGGGGAGGGCCGTGG - Intergenic
1146910213 17:36643644-36643666 GAAGGCTCTGAGCAGGGCAGGGG - Intergenic
1147142283 17:38466482-38466504 CCAGGCTCTGGGAAGGCACGGGG - Exonic
1147791200 17:43015268-43015290 GAAGGCACTGGGGAGTACAGGGG + Exonic
1148197816 17:45727385-45727407 GAAGGCTTTGAGGAGGCACTTGG - Intergenic
1148936345 17:51166771-51166793 GCAGGCTCTGGCGGGGCCCGCGG - Exonic
1151669409 17:75563825-75563847 GAAGGCTCTGGAGAGGAAAGAGG - Intronic
1151685216 17:75642260-75642282 TGAGGCTCTGGGGAAGCCCCGGG - Intronic
1151994879 17:77602263-77602285 GGAGGTTCTGAGGAGGCCTGCGG + Intergenic
1152107385 17:78338640-78338662 GAGGGCTCTGGTGAGGTCCCTGG - Intergenic
1152245521 17:79182961-79182983 GGAGTCTCCGGGGAAGCCCGAGG - Intronic
1152246069 17:79185161-79185183 GAAGGCTCAGGGGAGAGACGAGG + Intronic
1152251050 17:79212739-79212761 GCAGGCTGTGGGGAGGGGCGGGG + Intronic
1152280177 17:79380501-79380523 GGAGGCTCTGGGCAGACCCCAGG - Intronic
1152294594 17:79459308-79459330 GGAGGCGCTGGGGAGGCTGGAGG + Intronic
1152571142 17:81121771-81121793 CCCGGCTCGGGGGAGGCCCGTGG + Exonic
1152754392 17:82081110-82081132 GGAAGGGCTGGGGAGGCCCGGGG + Intronic
1152947055 17:83203636-83203658 GAGGTCTCTGGGGAGGTCCCAGG - Intergenic
1153689040 18:7573334-7573356 GGTGGCTCTGGGGAGGGCCTGGG + Intronic
1155170860 18:23266071-23266093 GAAGCCTCAGGGGAAGCCTGGGG + Intronic
1158309887 18:56146405-56146427 GAAGGCTCTGGAAAAGCCCCAGG - Intergenic
1159890756 18:73951147-73951169 GAAGCCTCTGGGTAGGACCCCGG - Intergenic
1160613585 18:80108103-80108125 GGAGGCTCTGGAGAGGGCGGTGG + Intergenic
1160831342 19:1106099-1106121 GATGGCTCTGGGGGGGCTTGGGG + Intronic
1160837890 19:1133105-1133127 GGAGGAGCTGGGGAGGCCCCAGG + Intronic
1160896375 19:1404033-1404055 GAAGGTTCTGGAGAGGACGGCGG + Intergenic
1160951947 19:1672034-1672056 GAGGGGTCTGGGGAGGACCCCGG - Intergenic
1160969535 19:1761440-1761462 TAGGGCTCTGGGGAGCCACGGGG - Intronic
1161018697 19:1997479-1997501 GAAGGCCCTGGTTAAGCCCGTGG + Intronic
1161323336 19:3651445-3651467 GAAGGCGCATGGGAGGCCAGAGG - Intronic
1161511527 19:4674937-4674959 TGAGGCTCTGGGGAGCCCGGGGG + Intergenic
1161628066 19:5338491-5338513 GAAGGCTTTGTGGAGGGCAGCGG + Intronic
1161871500 19:6874005-6874027 GAAGGTTCTGCAGAGCCCCGGGG + Intergenic
1161981364 19:7632137-7632159 GAAGGTTCTGGGGAGGCCAAAGG - Intronic
1162058508 19:8080413-8080435 GAGCGCTCTGGGGAGGCTCTGGG + Intronic
1162130419 19:8522731-8522753 GAGGGCCCCGGGGAGGCCTGTGG + Exonic
1162840081 19:13349894-13349916 GAAGGCTCTGGGTAGCCTTGTGG - Intronic
1163157082 19:15445465-15445487 GAAGGCTGGTGGGAGGCCTGGGG + Intronic
1163530208 19:17844294-17844316 ATAGGCGCTGGGGGGGCCCGGGG + Exonic
1163730837 19:18948389-18948411 GAAGGCACTGGGGAGCCATGGGG + Intergenic
1163790498 19:19303305-19303327 GGAGATTCTGGGGAGGCCTGTGG - Intronic
1164146893 19:22518001-22518023 GCAGGCTCAGGGCACGCCCGGGG - Intronic
1164617828 19:29677272-29677294 GAAGGCTCTGCGAAGGTCCTGGG - Intergenic
1164727416 19:30475675-30475697 GAAGGGGCTGGGGAGCCCAGTGG - Intronic
1165108486 19:33487933-33487955 GAGGGCCCTGGGGAAGCCCAGGG + Intronic
1165356559 19:35307984-35308006 CAAGGGTCTGGGGAGGCCGGGGG + Intronic
1166267293 19:41692131-41692153 GAGGGGTCTGGGGAGGCCTGAGG - Intronic
1166295687 19:41888186-41888208 GAGGGGCCTGGGGAGGCCTGTGG - Exonic
1166411811 19:42560565-42560587 GAATGCTGTGGGCAGGCCCTGGG + Intronic
1166785590 19:45364870-45364892 GAAGGCCCTGGGGCGGCGCCAGG - Exonic
1166932310 19:46308647-46308669 GACAGGGCTGGGGAGGCCCGGGG - Exonic
1167303997 19:48696485-48696507 GAAGCCTCTGAGGAGCCCCAGGG - Intronic
1167436401 19:49481100-49481122 GGAGGCTGTGGGAAGGCCCAGGG + Intronic
1167735960 19:51294704-51294726 GCTGGCGCTGGGGAGGCCCCGGG - Intergenic
1167964490 19:53132374-53132396 GCGGGCTCAGGGGAGGCCTGGGG + Intronic
1168097654 19:54124682-54124704 GAAGGCTCCAGGGGGGCCGGGGG - Intronic
1168319416 19:55500310-55500332 GATGGCTCCAGGGAGGCCTGAGG - Exonic
1168695166 19:58400152-58400174 GGAGGACCTGGGGAGGCCAGGGG + Intergenic
925164105 2:1705149-1705171 CACGGCTCCGGGGAGGCCCAGGG - Intronic
925376317 2:3388440-3388462 AAAGGCTCTGGCGACGCCGGGGG - Exonic
925557523 2:5147877-5147899 GAAGGCTCTGATGAGGCCCAGGG - Intergenic
925981368 2:9180072-9180094 GGAGGGTCAGGGGAGGCCCATGG - Intergenic
927600461 2:24435936-24435958 GGAGGCTCTGGGGAGCGCTGGGG + Intergenic
928301564 2:30129866-30129888 GAAGCCTCTGGGAAGGACAGAGG - Intergenic
929604435 2:43225683-43225705 GAAGGCGGTGGGGACGCCTGTGG - Exonic
929999831 2:46853783-46853805 GACCCCTCTGGGGAGGCCGGTGG + Intronic
930601672 2:53451134-53451156 CTAGGCTCTGAAGAGGCCCGAGG + Intergenic
932411388 2:71549922-71549944 GAAGGAGGTGGGGAGGCCCCTGG + Intronic
932707632 2:74038846-74038868 GTAGGCTCTGGGGCAGCCTGTGG + Intronic
935193027 2:100793496-100793518 GGAGGCTGTGGGGAGTCCCCAGG - Intergenic
935979804 2:108615573-108615595 GAAGGATCTGGGGAGCCCAGAGG + Intronic
936033011 2:109087162-109087184 GAAGGCTCTGGTCAGGGCCATGG + Intergenic
936152723 2:110030525-110030547 GATGGCTCAGGGGAGGGCGGGGG - Intergenic
936166225 2:110122067-110122089 GCAGGAGCTGGGGAGGGCCGCGG + Intergenic
936191957 2:110340887-110340909 GATGGCTCAGGGGAGGGCGGGGG + Intergenic
937236031 2:120432429-120432451 GAAGGCTCTGGGGTGGCGTGGGG - Intergenic
937237337 2:120438675-120438697 GAAGGCTCTGAGCAGGGCAGAGG - Intergenic
937314476 2:120922294-120922316 GAAGGGTCTGGGCAGGTCCCTGG + Intronic
937322874 2:120971455-120971477 GGAGGCTCTGGGGAGCCACCAGG - Intronic
937333051 2:121044138-121044160 GCAGGCTCTGGGGAAGCCTCTGG + Intergenic
938080414 2:128367139-128367161 AAAGGCACTGGGGAAGCCAGAGG + Intergenic
938341064 2:130536882-130536904 GAAGGCTCCGGGAAAGCCCAGGG - Intergenic
938348766 2:130583827-130583849 GAAGGCTCCGGGAAAGCCCAGGG + Intronic
938562995 2:132490924-132490946 GAAGGCTCTGTGGAGGGCAAAGG + Intronic
941916111 2:170815106-170815128 GAAGGCTCTAGGAGGGCCGGTGG + Intronic
942064421 2:172257104-172257126 GCTGGCTGTGGGGAGGCCCCTGG + Intergenic
942470541 2:176255214-176255236 GAGGGCTCTGTGGAGGGCAGAGG - Intergenic
945982008 2:216319924-216319946 GAAGGCTCTGGTGAGGAATGTGG - Intronic
946125105 2:217555821-217555843 GAAGGCTCTGCAGAGGCCACAGG - Intronic
947448546 2:230183523-230183545 CAGGGCTCTGGGGAGCCCAGTGG + Intronic
948570017 2:238912161-238912183 GCATGCTCTGCTGAGGCCCGTGG + Intergenic
1168842426 20:917937-917959 GAAGGCTCAGGGGAGGCTGGAGG - Intergenic
1168947033 20:1769526-1769548 GCAGGCTCTGGTTAGGCCCTAGG - Intergenic
1171437822 20:25136723-25136745 GAAGGCTCTGCTGTGGCCAGGGG + Intergenic
1171451145 20:25237056-25237078 GGAGGCTCTGAGGAGGGCCCAGG + Intergenic
1171982492 20:31637850-31637872 AAAGGCTGTGGGGCGGGCCGGGG + Intergenic
1172226767 20:33310549-33310571 GAAGGTACTGGGCAGGCCTGAGG - Intergenic
1173569292 20:44066371-44066393 GAAGGCTTTGGGAAGGGCCAGGG - Intronic
1173821037 20:46020952-46020974 GAAGGCTTTGGGGAGGATCCTGG - Intergenic
1174159619 20:48541530-48541552 CAAGGCTCTGGACAGGCCAGAGG + Intergenic
1175387621 20:58607509-58607531 GAGGGCTCCAGGGAGGCCCTGGG + Intergenic
1175522668 20:59612055-59612077 TAAAGCTCTGGGGAGGGCCCAGG - Intronic
1175715494 20:61252378-61252400 GGAGGCTCCGGGCAGGCGCGGGG + Intergenic
1175728024 20:61332637-61332659 GAAGGTTCTGCGAAGGCCCTTGG + Intronic
1175911442 20:62407156-62407178 GCAGGCGCTGCGGAGGCGCGGGG - Exonic
1175925594 20:62469841-62469863 GAGGAAACTGGGGAGGCCCGGGG + Intronic
1175937941 20:62523533-62523555 GAGGGCTCTGGGGAGGGCCGGGG - Intergenic
1175951859 20:62587863-62587885 GCAGGCACTGAGGAGGCCTGTGG + Intergenic
1176073950 20:63240097-63240119 AGAGGCTCTGGGGAGCCCCGAGG - Intronic
1176128023 20:63484567-63484589 GAAGGTTCTCGGGAGCCCCGGGG - Intergenic
1176151616 20:63594360-63594382 GGAGCCGCTGGGGAGGCCCTGGG + Intronic
1176177720 20:63736586-63736608 GGAGGCTCAGGGGAGGCGCTTGG + Intronic
1176301791 21:5102120-5102142 GGAGGCTCCAGGGAGCCCCGTGG + Intergenic
1178431178 21:32520116-32520138 GCAGGCTCTGGGGAGCCTAGAGG + Intergenic
1178940391 21:36900559-36900581 GAAGGTTCTGGGGAAGGTCGTGG + Intronic
1179396291 21:41043414-41043436 GAAGCTTCTGGGGAGGCCTCAGG + Intergenic
1179855240 21:44159780-44159802 GGAGGCTCCAGGGAGCCCCGTGG - Intergenic
1180105601 21:45616397-45616419 GAAGGGACTGGGGAGGCCAGCGG - Intergenic
1180181234 21:46119534-46119556 GAATGATCTGGGGAGGCTCCAGG - Intronic
1181024129 22:20117863-20117885 GCAGGCTCTGCAGAGGCCTGGGG + Intronic
1181471947 22:23145925-23145947 GAAGGCTCTAGGTGGGCCTGGGG - Intronic
1181609945 22:24005565-24005587 GTAGGCTGGGGAGAGGCCCGTGG + Intergenic
1181804439 22:25366442-25366464 GGAGGGGCTGGGGAGGCCGGGGG + Intronic
1182008590 22:26981813-26981835 GCAGGTTCTGGGCAGGCCCCCGG + Intergenic
1183674285 22:39291045-39291067 GAAGGCGCTGGGCGGGCCTGGGG - Intergenic
1183952009 22:41357496-41357518 GAAGGGTCAGGGCAGGCCAGGGG + Exonic
1184058262 22:42066752-42066774 GAAGGCGATGGGGCGGCCTGTGG + Exonic
1184429872 22:44436185-44436207 CCAGGCTCTGGGGAGGTCAGGGG - Intergenic
1184981470 22:48099004-48099026 GGAGGCTCTGGGGAGGGCCCCGG - Intergenic
949633267 3:5952871-5952893 CAAGGCTTTGGGGAGGCCCACGG + Intergenic
949670089 3:6389453-6389475 GAAGGTTCTGCGGAGCCCTGGGG - Intergenic
950644404 3:14368414-14368436 GAAGGCACTGGTGAGGACCTTGG - Intergenic
950764316 3:15262022-15262044 GGGGGCTCTGGTGAGGCCCCAGG + Intronic
952902812 3:38121095-38121117 GAAGACTCTAGAGAGGCCGGGGG + Intronic
952924952 3:38313959-38313981 GAAGGCTGTGGGCAGGCCACAGG - Intronic
953608084 3:44424771-44424793 GCAGTCTCTGGGAAGGCCCAAGG - Intergenic
954996729 3:54888491-54888513 GAGGGCTGTGGGGAAGGCCGTGG + Intronic
955911474 3:63863599-63863621 GAAGCAGCCGGGGAGGCCCGGGG + Intronic
956008994 3:64810429-64810451 GAAGGCTCTGGGCAGGAATGAGG + Intergenic
961655711 3:128440542-128440564 GAAGGCTCTGGGGCTTCCCCTGG - Intergenic
961673201 3:128549531-128549553 GAGGGGCCTGGGGAGGCCAGTGG + Intergenic
961743123 3:129046356-129046378 GGAGGCCCTGGGGACTCCCGCGG + Intergenic
961826586 3:129602342-129602364 GAAGGCTGTGAGCAGGCTCGAGG - Intronic
961922079 3:130437721-130437743 GAAAGCTCTGGGGAAGCGAGGGG - Intronic
962740843 3:138361701-138361723 CCAGGCTCTGGGGAGGCCAAGGG + Intronic
962850872 3:139307393-139307415 GAAGGCTCTGCAGAGGGCAGTGG - Intronic
966496863 3:180590673-180590695 CAGTGGTCTGGGGAGGCCCGCGG + Intergenic
967592802 3:191298516-191298538 AATGGCTCTGGGGAGGCCTCAGG - Intronic
967966243 3:194962236-194962258 GAAGGCTGCTGGGAGGCCAGAGG - Intergenic
968595501 4:1480194-1480216 GAAGGCACTGGGGCTGCCCCTGG + Intergenic
968661798 4:1801746-1801768 GAGGGCCCTGGGGCGGCGCGGGG + Intronic
968730594 4:2267637-2267659 GGTGGCTCTGGGGAGGCCTGGGG - Intergenic
968742612 4:2339179-2339201 AAGGGCTTTGGAGAGGCCCGAGG - Intronic
968962717 4:3753464-3753486 GAGGGCACTGGGGGGGCACGGGG + Intergenic
969426469 4:7127340-7127362 GGAGGCACTGGGCAGGCCCCAGG + Intergenic
969681240 4:8644607-8644629 CATGGCTCTGGGGAGGCTCCTGG + Intergenic
972284766 4:37637570-37637592 GAAGGCTCTGGGGGACCCCGGGG - Intronic
978879041 4:113678266-113678288 GCAGGCTCTGGTGAGACCCTGGG + Intronic
979473264 4:121125649-121125671 GAAGGCTCTGGAGAGGAGCAGGG + Intergenic
982842043 4:160201215-160201237 TAAGGGTATAGGGAGGCCCGAGG + Intergenic
984651865 4:182278931-182278953 GGAGGCTCTGGACAAGCCCGAGG + Intronic
985808739 5:2068018-2068040 GAAGGCTGTGTGGAGGCCATAGG + Intergenic
986255643 5:6100602-6100624 GAAGTCCATGGGGAGGCCCATGG - Intergenic
986255854 5:6101246-6101268 GAAGTCCATGGGGAGGCCCATGG - Intergenic
987046996 5:14117516-14117538 GGAGGATCTGGGGAGCCCTGTGG + Intergenic
987303555 5:16617475-16617497 AAAGGCGCTGGGGATGGCCGAGG - Intergenic
990393889 5:55355855-55355877 GAAGGCTCTGTGGAGGAATGGGG + Intronic
991254409 5:64598611-64598633 GAATGCTCTGAGGGGGCCCAAGG + Intronic
991281226 5:64916531-64916553 GAAGGCTCTGTGGTTGCCCCTGG - Intronic
996804051 5:127434881-127434903 GAAGGCCAAGGGGAGGCCTGAGG - Intronic
999329097 5:150660678-150660700 GAAGGCTCTGGGAGAGCCCAGGG - Intergenic
999908507 5:156169950-156169972 GAAGTCTCTGGGTGTGCCCGTGG + Intronic
1000343794 5:160297436-160297458 CATGGCTCTGGGGAGGTCCTGGG + Intronic
1000380064 5:160620908-160620930 CAAGGCTCTGGGGACGTCCCTGG - Exonic
1001307814 5:170588597-170588619 GAAGGATTTGGGGAGGCGAGGGG - Intronic
1001997439 5:176173685-176173707 GTGGACTCTGGGGAGGCCAGGGG - Intergenic
1002070908 5:176678498-176678520 GAAGGCTCAGAGGAGGCACTGGG + Intergenic
1005939495 6:30550302-30550324 GAAGGCTTTGGGGAGGAGAGGGG - Intronic
1007260125 6:40557512-40557534 GGAGACTCTGTGGAGGCCCTGGG + Intronic
1007405700 6:41634941-41634963 GAAGGCTCTGGGGTGGAGAGTGG + Intergenic
1007414197 6:41682694-41682716 GAAGGCTCCGGGAAGTCCCAAGG - Intergenic
1007421781 6:41724011-41724033 GGAGGCCCTGGGAAGGCCCAAGG - Intronic
1007909161 6:45495991-45496013 GGAAGCTGTGGGGAGGCCCTGGG - Intronic
1010397910 6:75413173-75413195 AAAGGCTCTTGGGAAGTCCGTGG - Intronic
1010926537 6:81752295-81752317 GGAGTCTCCGAGGAGGCCCGGGG - Intronic
1012903679 6:105038363-105038385 GGAGTCTCTGGAGAGGCCTGTGG + Intronic
1015466360 6:133552872-133552894 GAAGGCTCTGGGGCCGGGCGCGG + Intergenic
1017025751 6:150179084-150179106 GAAGGCACTGGGGAGACCCAGGG + Intronic
1017067485 6:150542837-150542859 GAAGGCCCTGGAGATGCCAGGGG + Intergenic
1017071295 6:150577365-150577387 GGAGGATGTGGGGAGGGCCGAGG - Intergenic
1017782388 6:157725950-157725972 GCAGGCTCTGTGCAGGCCTGTGG - Intronic
1018317138 6:162568458-162568480 GGAGGCTCTGGTGGGGCCGGCGG + Intronic
1018710303 6:166493988-166494010 GGAGACTCTGGGGAGACCCTTGG + Intronic
1018860977 6:167710295-167710317 GAAGGCCCTGGGGAGACGGGAGG + Intergenic
1019175861 6:170159276-170159298 GAAGGGGCTGGGGCGGGCCGGGG - Intergenic
1019521791 7:1463990-1464012 GAAGGCTCTGAGAAGTCCCGCGG - Intergenic
1019523498 7:1470756-1470778 GCTGGCTCTTGGGAGTCCCGAGG - Intronic
1019536383 7:1531525-1531547 GAAGGCCGTGGGGAGGCGGGAGG + Intronic
1019626615 7:2019139-2019161 GAGGACTCTGGGGAGGCGGGTGG - Intronic
1019732400 7:2635180-2635202 GAGGCCTCTGGCGTGGCCCGGGG + Intronic
1020087040 7:5316086-5316108 GGAGGCTCAGGGGAGGCCCTCGG + Intronic
1022164010 7:27740281-27740303 CAAGGCGCTGGGGTGGACCGGGG - Intronic
1022466185 7:30654596-30654618 GCAGGCTCTGGGGAGTCAGGCGG - Intronic
1022697875 7:32728180-32728202 GGAGGCGGTGGGGAGGCCCGGGG + Intergenic
1024506601 7:50167421-50167443 GAAGGCTCATGGGCTGCCCGTGG + Intergenic
1026764950 7:73154698-73154720 GAAGGCCGAGGGGAGGCACGGGG - Intergenic
1026959398 7:74398859-74398881 CAAGGCTCTAGGGAAGCCCCTGG - Intronic
1027041422 7:74964468-74964490 GAAGGCCGAGGGGAGGCACGGGG - Intergenic
1027082218 7:75237908-75237930 GAAGGCCGAGGGGAGGCACGGGG + Intergenic
1029381911 7:100220416-100220438 GAGGGCTCCTGGGAGGCCTGTGG + Exonic
1029390781 7:100272411-100272433 GAAGGCCGAGGGGAGGCACGGGG + Intergenic
1029402075 7:100352866-100352888 GAGGGCTCCTGGGAGGCCTGTGG + Exonic
1029625628 7:101718668-101718690 GAGGGCCCTGGGGAGGCCTGAGG + Intergenic
1029977167 7:104845664-104845686 GAAGGAGCTGGGGAGTCCTGGGG + Intronic
1030067958 7:105674824-105674846 GCAGGATCTGGGGAGTCCCAGGG + Intronic
1030134345 7:106232285-106232307 GAAGGCTCTGGGTGACCCCGAGG + Intergenic
1034336985 7:150330153-150330175 TAAGGCTCTGTGGAGGCCCAGGG + Exonic
1034392972 7:150800586-150800608 GACGGCCCTGGGAAAGCCCGTGG - Exonic
1035051310 7:156000501-156000523 GAAGGCTGTGGGGATGCAGGAGG - Intergenic
1035247439 7:157572933-157572955 GAAGGCTTTGGGGAGAGGCGGGG + Intronic
1036643917 8:10600681-10600703 GCAGGCTCTGGGGTGCACCGAGG - Intergenic
1036677023 8:10842638-10842660 TGAGGCTCTGGAGAGGCCCTGGG + Intergenic
1037649352 8:20822516-20822538 CAAGGCTCTGGGGAGGAGGGGGG + Intergenic
1037692970 8:21198260-21198282 GAAGGCTTTGTGGAGGCTGGGGG - Intergenic
1037770597 8:21796934-21796956 GAAAGCTCTTGGGAGGCCCAAGG - Intronic
1037904496 8:22707668-22707690 GGAGGCTCTGAGGTGGCACGTGG + Intergenic
1038804532 8:30778261-30778283 GGAGGGTCTGGGGAAGCCAGTGG - Intronic
1039493038 8:37962023-37962045 ACAGACTCTGGGGAGGCCAGCGG + Intergenic
1040318068 8:46275461-46275483 GAAGCCTCTGGGGAACCCCCGGG - Intergenic
1047230868 8:122996680-122996702 CATGGCTCTCGGGATGCCCGTGG + Intergenic
1047725311 8:127679248-127679270 GCTGGCTTTGGGGAGGGCCGGGG + Intergenic
1049158728 8:141083981-141084003 GCTGCCTCTGGGGAGGCCCCAGG - Intergenic
1049218465 8:141418175-141418197 GGGCGCTCTGGGGAGTCCCGGGG - Intronic
1049256560 8:141617225-141617247 GCAGGCGCTGCGGAGGCCCCCGG + Intergenic
1049366087 8:142237527-142237549 GGAGGCTCAGGGGAGGGCCCGGG - Intronic
1049450199 8:142656993-142657015 GAAGCCTCTGGGGAGGGCTTAGG + Intergenic
1049544063 8:143221431-143221453 GATGCCCCTGGGGAGGGCCGGGG + Intergenic
1050288520 9:4129624-4129646 GAAGCTTCTGGGGAGGCCTCAGG - Intronic
1051148955 9:14060050-14060072 GAGGGCTCTGGTGAGGGCCTTGG + Intergenic
1055680955 9:78714825-78714847 GAAGGCTCTGGGGAATCTTGTGG + Intergenic
1057600098 9:96450285-96450307 GGGCGCTCTGGGGAGTCCCGTGG + Exonic
1057828377 9:98388521-98388543 CAAAGCTCTGAGAAGGCCCGTGG + Intronic
1059365105 9:113780818-113780840 GAATGTTCAGGGGAGGCCTGGGG - Intergenic
1059800459 9:117745088-117745110 GCAGGATCTGGGCAGCCCCGCGG + Intergenic
1060521792 9:124298220-124298242 GAAGGAGGTGGGGAGGCGCGAGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060995817 9:127874491-127874513 GGAGGCTCTGGGGCTGCCGGAGG - Intronic
1061028573 9:128066520-128066542 GCAAGCTCTGGGGTGGCCTGGGG - Intronic
1061291850 9:129654939-129654961 GAAGGCTCTGGGAAGTCTCAGGG + Intergenic
1062002727 9:134224983-134225005 GAAGGCCCAGGGGAAGCCCCTGG + Intergenic
1062094965 9:134698421-134698443 GCAGGCTCTGGGTTGGCCTGTGG + Intronic
1062103634 9:134740962-134740984 AAGGGCCCTGGGGAGGCCGGTGG - Intronic
1062282998 9:135760244-135760266 GAAGCCACTGGGGTGGCCGGGGG - Intronic
1062629099 9:137455688-137455710 GGGGGCTGAGGGGAGGCCCGGGG - Intronic
1185456409 X:312993-313015 GGAGGGTCTGCGGGGGCCCGGGG + Intronic
1185604274 X:1358735-1358757 GAGGGCTCTGGGAAGGCCTTCGG - Intronic
1187149523 X:16669052-16669074 GAAGGCTATGGGGCTGCCTGTGG - Intronic
1187200914 X:17133028-17133050 GAAGGCGCTGGGGATGCCAAGGG - Intronic
1188214844 X:27463447-27463469 CAAGGCTCTGGAGAGGCCAGAGG + Intergenic
1197154229 X:123252736-123252758 TAAGGCTCTGGGCAGGCCATGGG - Intronic
1197376006 X:125682584-125682606 GAAGGCTCTTGGGGGGTCCCTGG + Intergenic
1197942115 X:131801430-131801452 GAAGGCACTGTGGAGGCTGGGGG + Intergenic
1198214760 X:134545809-134545831 GAAGGATCGGGTGAGGCGCGAGG - Intergenic
1198936170 X:141904159-141904181 GAAGGCATTGAGGAGGACCGGGG + Intronic
1200114269 X:153763303-153763325 GATGGGGCTGGGGAGGCCTGGGG - Intergenic
1200128312 X:153828586-153828608 GAGGGCTGTGGGGAGCCCCAAGG + Intronic
1200986995 Y:9311901-9311923 GATGGCTACGGTGAGGCCCGTGG - Intergenic
1201016728 Y:9611338-9611360 GATGGCTATGGTGAGGCCCGTGG - Intergenic