ID: 1114656074

View in Genome Browser
Species Human (GRCh38)
Location 14:24316366-24316388
Sequence GTGGTGAACCTGGCTGAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114656061_1114656074 29 Left 1114656061 14:24316314-24316336 CCTGGTGGTGCTCATCATCCTGA 0: 1
1: 0
2: 1
3: 13
4: 205
Right 1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 255
1114656064_1114656074 6 Left 1114656064 14:24316337-24316359 CCTTCGCCGCCTTCTGGCTGCCC 0: 1
1: 0
2: 1
3: 20
4: 245
Right 1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 255
1114656065_1114656074 0 Left 1114656065 14:24316343-24316365 CCGCCTTCTGGCTGCCCTACCAC 0: 1
1: 0
2: 2
3: 28
4: 343
Right 1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 255
1114656063_1114656074 11 Left 1114656063 14:24316332-24316354 CCTGACCTTCGCCGCCTTCTGGC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 255
1114656066_1114656074 -3 Left 1114656066 14:24316346-24316368 CCTTCTGGCTGCCCTACCACGTG 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114656074 Original CRISPR GTGGTGAACCTGGCTGAGGC GGG Exonic
900316427 1:2059448-2059470 GTGCTCAGCCTGACTGAGGCGGG + Intronic
901069169 1:6508715-6508737 GTGGAGAGCCTGCCTGAGGCTGG - Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
902981500 1:20126752-20126774 GTGCTGAGTCTGGCTGGGGCTGG - Intergenic
903176449 1:21584325-21584347 ATGGTCAACTTGGCTCAGGCTGG + Intergenic
903377783 1:22877180-22877202 GTGTTGGACCTGGGTGAGCCTGG + Intronic
903695639 1:25204557-25204579 GGCGTGAACCTGGCTGAGACAGG + Intergenic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
904918960 1:33991542-33991564 GTTGCAAAGCTGGCTGAGGCAGG - Intronic
905257843 1:36696548-36696570 GTGGAGAGCGTGGCTCAGGCTGG - Intergenic
906103748 1:43279478-43279500 GTGGCAAGCCTGGCTGAGGAGGG - Intergenic
906205087 1:43982327-43982349 TTGGTGGACCTGGCTAGGGCTGG + Intronic
906478358 1:46184771-46184793 GTGCTCAGCCTGGGTGAGGCAGG - Exonic
907109524 1:51914033-51914055 GTGGTTCTTCTGGCTGAGGCAGG - Exonic
909107483 1:71430816-71430838 GCAGTGAGCCAGGCTGAGGCAGG - Intronic
912417153 1:109517197-109517219 GTGGTGAGGCTGGGTGAAGCAGG + Intergenic
912438010 1:109675371-109675393 CTGGTGATCCTGGCAGTGGCTGG + Intronic
912440521 1:109693830-109693852 CTGGTGATCCTGGCAGTGGCTGG + Intronic
913436140 1:118849716-118849738 GTGGAGGACCTGGCTGAGAGAGG - Intergenic
913528183 1:119713220-119713242 GTGGTGGACAGGGCTGAGGCGGG - Intronic
915913922 1:159930226-159930248 GTGCTGGACCCGGCTGTGGCAGG - Exonic
918321106 1:183365624-183365646 GGCGTGCACCTAGCTGAGGCAGG + Intronic
919910680 1:202108870-202108892 GTGGTGACCTTGGTGGAGGCAGG - Intergenic
920699743 1:208208887-208208909 ATGGTGACCCTGGCTGAGCAGGG + Intronic
922700717 1:227758520-227758542 ATGCTGAGTCTGGCTGAGGCTGG + Intronic
1062837616 10:646305-646327 GTGGAGAGCCTGGGGGAGGCTGG - Intronic
1063161890 10:3424374-3424396 TGGGTGAACCTGGGTGTGGCAGG - Intergenic
1064236461 10:13580665-13580687 GTGGTAACCCTGGCTGAGGTGGG + Intergenic
1067669177 10:48304230-48304252 GTGGTGAATATGGATGAGTCGGG - Intergenic
1069702382 10:70436032-70436054 GTTGTGACACTGACTGAGGCTGG - Intronic
1069896489 10:71683411-71683433 CTGGTGAAGCTGGCTGTGACAGG - Intronic
1070717760 10:78734915-78734937 GTGGTGCAGGTGGCTGGGGCAGG - Intergenic
1071769205 10:88705891-88705913 GTGATGCAGCTGGATGAGGCAGG + Intergenic
1074575371 10:114663879-114663901 GTGGGGAACCTGGAGCAGGCAGG - Intronic
1076299052 10:129410870-129410892 GTGGTGTGCCTGGATGAAGCCGG + Intergenic
1077792979 11:5461434-5461456 GTGGAGACCCTGGGAGAGGCTGG + Intronic
1078758752 11:14234994-14235016 GTTCTGAACCTGGCTCAGGTGGG - Intronic
1080055536 11:27902701-27902723 TTGGTCAACTTGGCTAAGGCTGG - Intergenic
1080403238 11:31956133-31956155 GTGGTGAGCCTGGGTCAGGCAGG + Intronic
1083663262 11:64261870-64261892 CAGGAGCACCTGGCTGAGGCCGG + Intronic
1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG + Exonic
1084503074 11:69546336-69546358 GTGCCGACCCTGGCTGAGGGAGG + Intergenic
1084655112 11:70510519-70510541 GTGGTGGCGCTGGCAGAGGCAGG - Intronic
1084970938 11:72771746-72771768 GTGATGAACGTTGCAGAGGCTGG + Intronic
1085113869 11:73912790-73912812 GTAGTGAACATGGCAGAGGGTGG - Intronic
1087195617 11:95301595-95301617 GGGGTGAAGCTGGCTGGGCCAGG + Intergenic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1089183345 11:116597936-116597958 GTGGTGCCCCTTGCTGAGACAGG + Intergenic
1090399651 11:126440961-126440983 GGGGTGCCGCTGGCTGAGGCGGG - Intronic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1093117722 12:15232704-15232726 GTGTTGATCCTGGCTGATGGAGG + Intronic
1095373541 12:41499220-41499242 GTAGAGATCCTGGGTGAGGCAGG + Intronic
1096094489 12:48925346-48925368 GCGGTGTGCCGGGCTGAGGCTGG - Exonic
1096509566 12:52120172-52120194 GTGGTGCAGCCGCCTGAGGCTGG + Intergenic
1100473597 12:94915651-94915673 GTGGTGATATTGGCTGAGGTGGG - Intronic
1103014395 12:117482532-117482554 GTTGACAACCTGGCTGGGGCAGG + Intronic
1103082353 12:118035306-118035328 GGGGTCAACCTGGGTGTGGCTGG + Exonic
1104255584 12:127134177-127134199 GCGGCAATCCTGGCTGAGGCAGG - Intergenic
1105265127 13:18808791-18808813 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1109397698 13:61782273-61782295 CTGGTGAGACTGGCAGAGGCAGG - Intergenic
1109440057 13:62357974-62357996 ATGGTGAATCTTGCTGAGACTGG - Intergenic
1111522165 13:89419531-89419553 GTGCTGATCCTGTCTGAGACAGG - Intergenic
1113793354 13:113042208-113042230 ATGGTGAGCATGGCTGGGGCAGG + Intronic
1114331778 14:21644392-21644414 GTGGCAAATCTGGGTGAGGCAGG + Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1115768704 14:36648185-36648207 GTGGGGGACCTGCCTGAGCCGGG + Intergenic
1117508666 14:56427174-56427196 AGGGTGAGCCGGGCTGAGGCTGG + Intergenic
1117597403 14:57337419-57337441 GAGGTGAACCTGGCTGAGCTTGG + Intergenic
1120835379 14:89034441-89034463 ATGGTGAACGTAGCTGAAGCTGG + Intergenic
1120994813 14:90409036-90409058 GTAAAGAACCTGCCTGAGGCTGG - Intergenic
1121078933 14:91091833-91091855 ATGCTCAGCCTGGCTGAGGCAGG - Intronic
1121639368 14:95475099-95475121 GTGGTGCCCCTGTCTGAGGGTGG - Intronic
1121762098 14:96454588-96454610 TTGGTGGCCCAGGCTGAGGCAGG - Intronic
1122552760 14:102558898-102558920 GTGGGGAGCCAGGGTGAGGCTGG - Intergenic
1122896765 14:104761570-104761592 GTGAGGAAACTGCCTGAGGCTGG + Intronic
1202833349 14_GL000009v2_random:59330-59352 GTGGTAATCCTGGCTGCTGCAGG - Intergenic
1124089278 15:26582564-26582586 GTGTAGATCCTGGGTGAGGCTGG - Intronic
1125545077 15:40497511-40497533 GTGGTAGACATGGCAGAGGCAGG - Intergenic
1125726662 15:41871708-41871730 GTGGGGAAGCTGGCTCTGGCGGG - Intronic
1126996664 15:54452386-54452408 GTGTTGAACATGGCTGAGACAGG + Intronic
1127922559 15:63504779-63504801 TTGGGGAACTTGGCTGAGTCCGG - Exonic
1128183539 15:65625275-65625297 GTGGTGAGCATGGCTGGGGTTGG - Exonic
1128758657 15:70199859-70199881 CTGCTGAAGCTGGCAGAGGCCGG + Intergenic
1129661036 15:77552994-77553016 GGAGGGGACCTGGCTGAGGCCGG + Intergenic
1130251574 15:82303514-82303536 GGGGTGAAACTGGCTGAGCACGG - Intergenic
1130320249 15:82835554-82835576 GTGGGCAACCTGGCAGTGGCTGG - Exonic
1132673952 16:1114062-1114084 GTGGTGAATGGGGGTGAGGCTGG - Intergenic
1132831788 16:1932101-1932123 GTGGTGATCCTGGTGGGGGCTGG - Intergenic
1132945645 16:2530275-2530297 GTGGTGACCCTGCCTGGTGCTGG + Exonic
1133877381 16:9748077-9748099 TTTGTGAACCTGGCTCAGACTGG + Intergenic
1134133676 16:11666403-11666425 GTGGGGCAGCTGGCTGAAGCTGG + Intergenic
1135066700 16:19316135-19316157 GTGGTGAACTTGGCTGAAGGAGG + Intronic
1136030770 16:27501243-27501265 GTGCGGAACCTGTCTGAGGAAGG - Exonic
1136335654 16:29608724-29608746 GAGGTGGGCTTGGCTGAGGCTGG - Intergenic
1136553530 16:30994664-30994686 GTGAGTCACCTGGCTGAGGCTGG - Intronic
1138054611 16:53819878-53819900 GTGGAGATCTTGGCTGGGGCAGG - Intronic
1138332774 16:56228224-56228246 GTGGTGGCCCTGGCTAAGCCTGG - Intronic
1139911490 16:70400075-70400097 GGGGAGAACCTGGCTGTGTCAGG + Exonic
1142175344 16:88642659-88642681 GTGGGGGACGTGGCTGACGCCGG + Intergenic
1142419886 16:89963684-89963706 GTGGTCAACCTGCCTGACGAGGG - Intronic
1143258641 17:5582650-5582672 GAGGTGAGGCTTGCTGAGGCAGG - Exonic
1146681753 17:34813406-34813428 GAGGTGAAGCTGGCATAGGCAGG - Intergenic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1147999054 17:44377042-44377064 GTGGGGAATCTGGAAGAGGCTGG - Exonic
1148769006 17:50056271-50056293 GCTGTGAAACTGGCTGGGGCTGG + Intronic
1148853285 17:50565070-50565092 GTCGCCATCCTGGCTGAGGCAGG - Intronic
1149669254 17:58391365-58391387 GTTCTGCACCTGGCTGATGCTGG - Intronic
1152000211 17:77640547-77640569 GGGGTGGACCTGGGTGGGGCCGG + Intergenic
1152662501 17:81549266-81549288 GTGGTCATCCTGGCTGGGCCAGG + Exonic
1152707506 17:81852356-81852378 GTGGGCAGCCTGGCTGAGTCGGG - Intronic
1154423266 18:14252753-14252775 GTGGTAATCCTGGCTGCTGCAGG - Intergenic
1156359288 18:36370079-36370101 GTTGTGAACCTGGCTGAATCTGG + Intronic
1157324095 18:46656853-46656875 GTGGTGCAGCTGGCTGCGGTGGG - Intronic
1157761715 18:50270162-50270184 GTGGGGAAGGTGGCAGAGGCTGG + Intronic
1158605868 18:58895569-58895591 CTGTTGGAGCTGGCTGAGGCTGG + Intronic
1159633489 18:70777929-70777951 GTGGTGTATGTGGCCGAGGCTGG - Intergenic
1160194319 18:76739775-76739797 GTCCTGAACCAGGTTGAGGCGGG + Intergenic
1161204593 19:3034415-3034437 AAGGTGAAGCTGGCTGGGGCAGG - Intronic
1161595950 19:5151099-5151121 GTGGGCACCCTGGCTGGGGCTGG - Intronic
1161621273 19:5298625-5298647 GATGTGAACATGGGTGAGGCGGG - Intronic
1162463090 19:10824862-10824884 GGGGTGACCCTGGCTGATGCTGG - Intronic
1162967888 19:14164572-14164594 GTGGGGGGCCTGGCTGGGGCGGG - Intronic
1164738158 19:30557497-30557519 GTGGACAACCTGGCTGGGGGTGG + Exonic
1164810032 19:31148295-31148317 GGGGTGAACCTGCTGGAGGCTGG + Intergenic
1166163687 19:40971212-40971234 GTGGCAAGCCTGGCTGAGGGAGG - Intergenic
1166293618 19:41878495-41878517 GTGCTGGGCCTGGCTGAGGCTGG + Intronic
1166375325 19:42324335-42324357 GTGGTGACCATGGCCGAGCCGGG + Intronic
1167722014 19:51185657-51185679 CAGGTGACCCTGCCTGAGGCTGG + Intergenic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
1202639320 1_KI270706v1_random:68365-68387 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
926358404 2:12062550-12062572 CAGGGGAACCTGGCAGAGGCAGG - Intergenic
927928142 2:27027051-27027073 GTGGTGAACCAGGCTGCTGGAGG - Exonic
928229559 2:29485692-29485714 GGGGTGAGCCTGGCTGGGGAAGG - Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
929455299 2:42060932-42060954 TTGCTGACCCTGGCTAAGGCAGG - Intergenic
930302384 2:49633021-49633043 TTGGTGAGCCTGGATTAGGCTGG + Intergenic
931227547 2:60345835-60345857 TTGGTGAAGCTGTCTGAGCCTGG - Intergenic
931916742 2:66964318-66964340 CTGGTGAACTTGGCTGATTCAGG - Intergenic
931984329 2:67727096-67727118 GTGGTTAAACCTGCTGAGGCTGG - Intergenic
934494782 2:94787829-94787851 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
936021506 2:108998496-108998518 GTGGTGGTCCTGGCTGATTCAGG - Intergenic
936061068 2:109296067-109296089 GGGGCCAACCTGGCTGGGGCAGG - Intronic
937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG + Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937483357 2:122287206-122287228 GAGGAGAACTTGGCTAAGGCAGG + Intergenic
941233848 2:162944669-162944691 GTGGTGAATCCTGCTGAGACTGG - Intergenic
943932185 2:193868319-193868341 ATGGTGAGTCTGGCTGAGTCCGG - Intergenic
944706861 2:202298518-202298540 GGCGGGCACCTGGCTGAGGCAGG + Intronic
944860330 2:203810165-203810187 GAGGTGATCCTGGCAGAGGAGGG + Intergenic
945969395 2:216221258-216221280 GAGGGGGACGTGGCTGAGGCAGG - Intergenic
946155828 2:217806076-217806098 GGGGTGATCCTGGCAGAGGGAGG + Intronic
948599368 2:239099687-239099709 GTGGAGTACCTAGCGGAGGCGGG - Intronic
1169238912 20:3957901-3957923 GTGGAGAATCAGGCTGAGACTGG - Intronic
1169346995 20:4836487-4836509 GTGGTAAACCTGGGTCAGCCAGG + Intergenic
1169645199 20:7802943-7802965 GTGGTCTAGCTGGCTCAGGCAGG + Intergenic
1171885916 20:30652480-30652502 GTGGTAATCCTGGCTGCAGCAGG + Intergenic
1172698709 20:36839533-36839555 GTGGGGGACCTGGATGTGGCAGG + Intronic
1175106338 20:56617682-56617704 GAGGTGGACCTGGCTGATGAGGG + Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1176647645 21:9365974-9365996 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
1176702966 21:10080461-10080483 TAGGTGAACCAGGCTCAGGCAGG + Intergenic
1176850209 21:13907256-13907278 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1180362626 22:11913499-11913521 GTGGTAATCCTGGCTGCTGCAGG - Intergenic
1182251614 22:29005177-29005199 ATTGTGAGCCTGGCTGGGGCAGG - Intronic
1183094408 22:35543489-35543511 GAGGTCAGCCTGGCTGAGGATGG + Intronic
1183150170 22:36030563-36030585 GGGTTTAACCTGGCTGGGGCTGG + Intergenic
1183600928 22:38840318-38840340 GGGGTGATCCAGGCAGAGGCAGG + Intronic
1183702567 22:39458164-39458186 GGAGGGAACCTGGCTGAGGGAGG + Intronic
1183935294 22:41258419-41258441 GTGGGGACCCTGGCTGTGGTGGG + Intronic
1184297641 22:43535235-43535257 ATAGTGAGCCTGGCTGGGGCTGG + Intronic
1184687611 22:46103726-46103748 GTGCTGAGCTTGGCTGGGGCAGG + Intronic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950429312 3:12941757-12941779 GTAGTGATCCGGGCTCAGGCTGG + Exonic
950672402 3:14535180-14535202 GGGGCGAAGCTGGCTGGGGCTGG - Intronic
953086320 3:39671515-39671537 GTGCTGAACCTGGTTGAGTGAGG - Intergenic
953244328 3:41176934-41176956 GAGGTGAACCTGGCTGGTGGGGG + Intergenic
954692573 3:52403442-52403464 CTGCTGCACCTGGCTGAGGATGG - Exonic
956635265 3:71357682-71357704 GTAGTTTTCCTGGCTGAGGCAGG - Intronic
957217289 3:77336726-77336748 GTGGTACACCAGGCTTAGGCAGG - Intronic
958514295 3:95092527-95092549 GAGGTGGACTTGGCTGAGGATGG + Intergenic
959498928 3:107082933-107082955 GTGGTGAACCTGACAGAGCCTGG + Intergenic
960885562 3:122390593-122390615 GTGGTCAGCCAGGGTGAGGCTGG - Intronic
961972281 3:130982086-130982108 TTTGTGAACCTGGGTTAGGCAGG - Intronic
962740424 3:138359267-138359289 GTGGTGAACCAGGCTGGAGGTGG - Intronic
963939475 3:151085513-151085535 GGGGTGAACCTGGGCGAGGGAGG - Intergenic
964285101 3:155109305-155109327 GTGCTGAAGCTGGATGATGCAGG - Intronic
964428591 3:156579778-156579800 ATTATGAACCTGGCTGAGGTGGG - Intergenic
966871214 3:184291534-184291556 CTGGTGAATGGGGCTGAGGCTGG + Intronic
966942781 3:184757512-184757534 GTGGTGACCCTGGCTCAGATAGG - Intergenic
967307388 3:188072238-188072260 GTGATGTCCCTGGCTGATGCGGG - Intergenic
967515888 3:190368036-190368058 GTGGCATACCTGGCTGTGGCAGG + Intronic
1202739234 3_GL000221v1_random:39013-39035 GTGGTAATCCTGGCTGCTGCAGG - Intergenic
968737728 4:2306116-2306138 GCAGGGCACCTGGCTGAGGCCGG + Intronic
969268871 4:6085377-6085399 GTGGGGGACCAGCCTGAGGCTGG + Intronic
969469887 4:7381547-7381569 GTGGTGTCCCTGGCGGAGGGAGG + Intronic
970523388 4:16908010-16908032 GTGGTGACCGTGGGTAAGGCTGG + Intergenic
971599137 4:28569872-28569894 GTAGGGACCCTGGCAGAGGCAGG - Intergenic
972436536 4:39040756-39040778 GTGGTGAAGAGAGCTGAGGCTGG + Intergenic
973369561 4:49234725-49234747 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
973391471 4:49560691-49560713 GTGGTAATCCTGGCTGCTGCAGG - Intergenic
974865439 4:67575196-67575218 GTGCTGAACCTGGCTCACACAGG - Intronic
975768555 4:77695995-77696017 GTGGTAAATCTGCCTGAGGTGGG + Intergenic
977168732 4:93733307-93733329 GTTGTGAACCTGTGTGAGGCAGG - Intronic
978885568 4:113762355-113762377 GCAGTGAACCCTGCTGAGGCTGG - Intergenic
980375160 4:131936835-131936857 TAGGTGAACCAGGCTCAGGCAGG + Intergenic
980963783 4:139501277-139501299 GTGCTGAACTTGGATGAAGCTGG + Intronic
982984008 4:162181296-162181318 GAGGCGGAGCTGGCTGAGGCAGG - Intergenic
983686975 4:170421998-170422020 ATGGTGAAACTTGCTGAAGCTGG - Intergenic
985423878 4:189810535-189810557 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423898 4:189810612-189810634 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423909 4:189810645-189810667 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423920 4:189810678-189810700 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423939 4:189810744-189810766 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423950 4:189810777-189810799 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423970 4:189810843-189810865 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423981 4:189810876-189810898 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
1202766675 4_GL000008v2_random:154235-154257 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
985627857 5:999328-999350 GGGGTGCCCATGGCTGAGGCAGG - Intergenic
986739398 5:10692873-10692895 GTGGTGAGCCAGGCTGGAGCAGG - Intronic
988961839 5:36378620-36378642 GTGGTGAGAGAGGCTGAGGCAGG - Intergenic
990910255 5:60844645-60844667 GAGGAAAACCTAGCTGAGGCTGG + Intergenic
992750105 5:79853783-79853805 GCCGTGATCCTGCCTGAGGCTGG + Intergenic
996494682 5:124140239-124140261 GTGAAGAAACTGCCTGAGGCTGG + Intergenic
998035800 5:138914788-138914810 CTGCTGGACCTGGATGAGGCAGG - Intronic
998190691 5:140021765-140021787 GTTGTGTTCCTCGCTGAGGCTGG - Intronic
1002407457 5:179046978-179047000 GTGAGGAAACTGCCTGAGGCTGG - Intergenic
1005491946 6:26355198-26355220 TTTGTGAACCTGCCTGAGCCTGG + Intergenic
1006038543 6:31234026-31234048 GTGGTGCTACTGGCTGTGGCGGG + Intergenic
1006514726 6:34539495-34539517 GTGGTGAGCCAGGCAGCGGCAGG - Exonic
1007484395 6:42170852-42170874 GTGGAGAAGCTGACTGAAGCAGG + Intronic
1011664574 6:89622090-89622112 CAGGTGAACCTGGCCGAAGCAGG - Intronic
1013458844 6:110357093-110357115 TTGGAGAACGTGGTTGAGGCTGG + Intronic
1013625132 6:111929299-111929321 GTGGGGAACATGGATGAAGCTGG - Intergenic
1016174328 6:141060208-141060230 TTTGAGAACCTGGCTGAGGTAGG - Intergenic
1016936074 6:149450484-149450506 TTGGTGATCCTCACTGAGGCCGG - Intronic
1017724833 6:157269633-157269655 GTGGTAAACCAGGCTGAGCTCGG + Intergenic
1019570770 7:1711022-1711044 CTGCTGATCCTGGCTCAGGCGGG - Intronic
1022978003 7:35576053-35576075 TTGGTTAGCCTGGCTGAGTCTGG + Intergenic
1023060019 7:36317881-36317903 GTGGGGACCGAGGCTGAGGCTGG - Intergenic
1023889413 7:44381757-44381779 CTCGTGAACCTGCCTGAGGGTGG + Exonic
1023988547 7:45112976-45112998 TTGGTCAAGCTGGCTGAGGTGGG + Intergenic
1025928251 7:65975946-65975968 GTGGTGACCCTGGCTTCAGCAGG - Intronic
1028216237 7:88137027-88137049 GTGGTTACCTTGGCTGGGGCTGG - Intronic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029201443 7:98841883-98841905 CCGGTGCACCTGGCAGAGGCTGG + Intergenic
1030369285 7:108678794-108678816 ATGAAAAACCTGGCTGAGGCAGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035754581 8:2022069-2022091 GTGAGGAGCATGGCTGAGGCTGG + Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1040101884 8:43513048-43513070 GTGGTAATCCTGGCTGCTGCTGG - Intergenic
1041931843 8:63295598-63295620 GTGGAGAAACCAGCTGAGGCTGG - Intergenic
1049365803 8:142236324-142236346 GTGGGGAGCCTGGCAGGGGCAGG + Intronic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1053004673 9:34596630-34596652 GTGGTGAGGATGGCGGAGGCTGG + Intergenic
1053662335 9:40292530-40292552 GTGGTAATCCTGGCTGCTGCAGG - Intronic
1053912788 9:42922697-42922719 GTGGTAACCCTGGCTGCTGCAGG - Intergenic
1054374464 9:64438759-64438781 GTGGTAATCCTGGCTGCTGCAGG - Intergenic
1054522275 9:66083754-66083776 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1061025881 9:128049146-128049168 GTGGAGAAGTTGGCTGAGGGCGG + Intergenic
1061191001 9:129082639-129082661 GTGATGGACCTGGCTGAGCCTGG + Intronic
1061263763 9:129494122-129494144 ATGGGGAATCTGGCTGGGGCGGG + Intergenic
1061499502 9:130993849-130993871 GTGGTGAGCAAAGCTGAGGCTGG - Intergenic
1202787992 9_KI270719v1_random:50570-50592 TAGGTGAACCAGGCTCAGGCAGG + Intergenic
1203547428 Un_KI270743v1:139113-139135 GTGGTAATCCTGGCTGCTGCAGG + Intergenic
1186420290 X:9420186-9420208 GTGGGGAACTGGGCTCAGGCAGG + Intergenic
1187098254 X:16168569-16168591 GTTCTGAACCTGGCTCAGGGTGG - Intronic
1190064114 X:47228866-47228888 CAGGTGAACATGGCTCAGGCAGG - Exonic
1190916472 X:54814816-54814838 GGGGTGCCCCTGGCTGGGGCAGG + Intronic
1192676182 X:73199196-73199218 GTGGTGAATCCTGCTGAGACTGG - Intergenic
1198936997 X:141908890-141908912 GTGGAGGGCCTGGTTGAGGCTGG + Exonic
1200411773 Y:2868347-2868369 GTCGGGAACCTGTCAGAGGCGGG - Intronic