ID: 1114656111

View in Genome Browser
Species Human (GRCh38)
Location 14:24316545-24316567
Sequence GGGCTTCGTCGCCAAGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114656101_1114656111 26 Left 1114656101 14:24316496-24316518 CCGTGCTGTACGCGTGCGCCGGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1114656098_1114656111 28 Left 1114656098 14:24316494-24316516 CCCCGTGCTGTACGCGTGCGCCG 0: 1
1: 0
2: 0
3: 4
4: 5
Right 1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1114656108_1114656111 -2 Left 1114656108 14:24316524-24316546 CCTGCTGCGCTCGGCGGGCGTGG 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1114656104_1114656111 8 Left 1114656104 14:24316514-24316536 CCGGCGGCGGCCTGCTGCGCTCG 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1114656099_1114656111 27 Left 1114656099 14:24316495-24316517 CCCGTGCTGTACGCGTGCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114656111 Original CRISPR GGGCTTCGTCGCCAAGCTGC TGG Exonic
900431756 1:2606042-2606064 GGGCCTCCTGGCCAAGCTGGGGG - Intronic
901853194 1:12029073-12029095 GGCCTTCTTCTCCAAGCTGCAGG + Exonic
904167194 1:28564914-28564936 GGTCTTAATCGCCATGCTGCAGG - Intronic
905866530 1:41379893-41379915 GGGCATCGTTGCCTAGCTGTGGG + Intronic
907298298 1:53469639-53469661 GGGCTGCCTGGCAAAGCTGCGGG - Intergenic
912420032 1:109536418-109536440 GGCCTCCCCCGCCAAGCTGCTGG - Intergenic
913291327 1:117274880-117274902 GGGCTTCTTGTCCCAGCTGCTGG - Intergenic
920768910 1:208861437-208861459 GGGCTTCATCCCCAAAATGCAGG + Intergenic
922119104 1:222644562-222644584 AGCCTTCATAGCCAAGCTGCTGG + Intronic
1065540096 10:26755661-26755683 AGGCTTCGTGGCCAGGGTGCAGG - Exonic
1075410778 10:122226359-122226381 GGGCATCGTCGTCCTGCTGCAGG - Exonic
1075953059 10:126498630-126498652 GAGCTTCTTCCCCCAGCTGCTGG + Intronic
1077111791 11:865295-865317 GGGCTTCCTCCCCAGGCTGGGGG - Intronic
1077352585 11:2099780-2099802 GGCCCTCGTGGCCAGGCTGCTGG + Intergenic
1078266273 11:9758255-9758277 GGGCTTCGCCGCCAGGTGGCAGG + Intergenic
1084264454 11:67997674-67997696 GGCCTTCCTGGCCATGCTGCTGG - Exonic
1089432753 11:118436842-118436864 GGGCTTCGACGCGGCGCTGCAGG + Exonic
1089535525 11:119158619-119158641 TGGCATCGTCGCCAATATGCAGG - Exonic
1090543357 11:127733704-127733726 GGGCTATGTCTCCAGGCTGCTGG - Intergenic
1108220934 13:48233049-48233071 GGGATCCGGCGCCCAGCTGCGGG + Intergenic
1110595594 13:77317515-77317537 GGGCATCATGCCCAAGCTGCAGG + Intronic
1111485895 13:88897492-88897514 TGGCTTCCTCGCAAAACTGCAGG + Intergenic
1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG + Exonic
1121857501 14:97283556-97283578 GTGCTTCTTCACCAAGCTACCGG - Intergenic
1123067460 14:105625827-105625849 GGTCTTCGTGCCCAAGCTGCTGG + Intergenic
1123507961 15:20964346-20964368 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1123565179 15:21538088-21538110 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1123601442 15:21975375-21975397 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1127342720 15:58065151-58065173 AGGCTGCGTGGCCAAGCTGACGG + Intronic
1129263981 15:74384166-74384188 GGGCTTTTTCACCAAGCTGATGG + Intergenic
1130301139 15:82680494-82680516 GGGCGTCATCGCCAAGGCGCTGG - Exonic
1202973550 15_KI270727v1_random:265194-265216 GCCCTTCTTCCCCAAGCTGCCGG - Intergenic
1132592928 16:734228-734250 GGACTTCTTCGCCCAGCAGCAGG - Exonic
1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG + Exonic
1133095606 16:3443191-3443213 GGACTTCGTGACAAAGCTGCGGG + Exonic
1134486394 16:14662044-14662066 GGACATCGTCACCAAGCTTCTGG + Exonic
1135797902 16:25463241-25463263 GGGCTTTGTGGTCAAGCTTCTGG + Intergenic
1136536432 16:30902431-30902453 GGTCTTCCCCGCCAAGGTGCTGG + Exonic
1140483984 16:75279511-75279533 GGGCTGGGTCTCCAAGCGGCAGG + Intergenic
1141715572 16:85724983-85725005 GCGCTTCGTCTCCCACCTGCTGG + Intronic
1146124669 17:30221944-30221966 GGGCGTCGTCTCCATCCTGCTGG + Exonic
1149952893 17:61010164-61010186 GGGCTTTGTTGCCACGCTGGAGG - Intronic
1151815429 17:76469337-76469359 GGGCTGCGACGCCCAGCTCCAGG + Intronic
1152225349 17:79090268-79090290 CGGCTTCCTCGCCAGGCTGGGGG + Intronic
1152351036 17:79784255-79784277 GGCCTTCAGCGCCAACCTGCTGG - Exonic
1153062760 18:1011185-1011207 GGGCATCCTCACCAAGCTGCAGG + Intergenic
1154137777 18:11795707-11795729 TGGCTGTGTCACCAAGCTGCAGG + Intronic
1154305779 18:13229794-13229816 TGGCTTTGTCGCCAAACTGGTGG + Intronic
1160273720 18:77410970-77410992 GGACTTCGTCTCATAGCTGCCGG + Intergenic
1163474618 19:17517694-17517716 GGGCTTCCTCCCCAAGGAGCGGG + Exonic
1167423196 19:49415649-49415671 GGGCTTCGGGGCCAGGGTGCTGG - Intronic
1167887679 19:52515632-52515654 GCCCCTCGTCGCCAAGTTGCAGG - Intergenic
1167918623 19:52762576-52762598 GTCCCTCGTCGCCAAGTTGCAGG + Intergenic
1167929928 19:52855847-52855869 GCCCTTCGTCGCAAAGATGCAGG + Intronic
938690147 2:133780372-133780394 TTGCTTCCTGGCCAAGCTGCAGG - Intergenic
938922561 2:136008537-136008559 GTGCTTCTTCTCCAAGCTGTGGG - Intergenic
942777420 2:179599911-179599933 GGGCTACGAGGCAAAGCTGCTGG + Intronic
942869167 2:180714103-180714125 AGGCTTCATCGCCAGGATGCAGG + Intergenic
946369251 2:219270590-219270612 GGGCTGCCTGGCCAAGCTGTGGG + Intronic
948827031 2:240577826-240577848 GGGCCTCGTCCCCAAGCAGCAGG - Exonic
1169122731 20:3107067-3107089 GGGCCTCGCAGCCCAGCTGCAGG + Intergenic
1170567345 20:17614632-17614654 GGGCGGAGTCGTCAAGCTGCTGG - Intronic
1171152105 20:22836192-22836214 GGGCTTCTTCCCACAGCTGCTGG - Intergenic
1171430748 20:25081964-25081986 GGGCTTGGAGGCCGAGCTGCCGG - Exonic
1175444855 20:59013071-59013093 GGGCTCAGCCTCCAAGCTGCAGG + Intergenic
1182722196 22:32412063-32412085 GGGCTTCGTGCCCAACATGCAGG - Exonic
1183217446 22:36490076-36490098 GCTCTTGGTCGCCAAGCTGCTGG + Exonic
1184130258 22:42513224-42513246 GGGCTTCATCTCCAGGCTGGGGG - Intronic
1184140436 22:42575052-42575074 GGGCTTCATCTCCAGGCTGGGGG - Intergenic
964723169 3:159788087-159788109 GAGCTTAGTCTCCAGGCTGCGGG - Intronic
967100356 3:186210733-186210755 GGGCTTAGAGGCCAAGCTGGTGG + Intronic
967183941 3:186929956-186929978 AGGCTTCCACCCCAAGCTGCAGG - Intergenic
968065448 3:195756379-195756401 GGGCTTCGCCGCAGAGCTGTGGG + Intronic
968831946 4:2936915-2936937 GAGCCTCATCTCCAAGCTGCTGG + Intergenic
972731514 4:41799638-41799660 TGGCTTCCTCGCTGAGCTGCAGG - Intergenic
984734501 4:183098100-183098122 GGGCCTGGACGCCAAGCTTCAGG - Intergenic
985005854 4:185535185-185535207 GGGCTTCGGCGCCCAGCTCCGGG - Intronic
985780149 5:1866270-1866292 GCGCTTCGCCGCCCAGCTGTGGG + Intergenic
987298161 5:16572750-16572772 GGGCTGCAGAGCCAAGCTGCAGG + Intronic
990694480 5:58400578-58400600 GGGCTTCTTCCTCCAGCTGCGGG + Intergenic
990694566 5:58401589-58401611 GGGCTTCTTCCTCCAGCTGCGGG + Intergenic
991245705 5:64506532-64506554 GGGCGCCGCCGCCAAGCAGCCGG - Exonic
1004049220 6:12058688-12058710 GGGCTGCTTGCCCAAGCTGCTGG - Intronic
1018859299 6:167699171-167699193 GGGTTTCCTCCCCCAGCTGCAGG + Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024048675 7:45602365-45602387 GGGCTTCCTGGACAGGCTGCAGG - Intronic
1026023991 7:66731001-66731023 GGGATTCGGGGCCAGGCTGCGGG + Intronic
1028111859 7:86950484-86950506 GGGCTCTGTCTCCAAGCTTCTGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1034950920 7:155296998-155297020 GCGTTTCCTCGCCACGCTGCAGG + Intergenic
1041095161 8:54342565-54342587 GGGCTGTGTAGCCAGGCTGCTGG - Intergenic
1049452498 8:142669774-142669796 GGGGTTGGTCGCGAGGCTGCGGG - Intronic
1054928469 9:70611807-70611829 GGTCCTCATCTCCAAGCTGCTGG + Intronic
1060980580 9:127789291-127789313 GGACCTCATCGACAAGCTGCTGG + Exonic
1062556167 9:137114278-137114300 GGCCTTCGTCGCGGAGCTGGCGG - Exonic
1188363228 X:29282418-29282440 GGGAAACATCGCCAAGCTGCTGG + Intronic
1189316602 X:40061349-40061371 GGGCTTTGGAGCCAGGCTGCTGG + Intronic
1197415193 X:126165696-126165718 GGGCTTCGAGGGCGAGCTGCGGG - Exonic
1197445917 X:126552380-126552402 GGGCTTCGATGGCGAGCTGCGGG - Exonic
1199371282 X:147052552-147052574 TGGTTTCATCGCCAACCTGCAGG + Intergenic
1200143402 X:153913254-153913276 GAGCATCCTCGCCAAGCTGCAGG - Exonic
1200963173 Y:9013481-9013503 GGTCTCCGCCGCCAAGCTGAGGG + Intergenic