ID: 1114656750

View in Genome Browser
Species Human (GRCh38)
Location 14:24320517-24320539
Sequence GAGAGCAGGGAGCAGGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 616}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114656743_1114656750 22 Left 1114656743 14:24320472-24320494 CCTTGTGTCTGTAAGAGAAGAAA 0: 1
1: 1
2: 1
3: 41
4: 624
Right 1114656750 14:24320517-24320539 GAGAGCAGGGAGCAGGCGGTGGG 0: 1
1: 0
2: 6
3: 53
4: 616
1114656744_1114656750 -1 Left 1114656744 14:24320495-24320517 CCAGAAAAGAACTACTGATCTTG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1114656750 14:24320517-24320539 GAGAGCAGGGAGCAGGCGGTGGG 0: 1
1: 0
2: 6
3: 53
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114656750 Original CRISPR GAGAGCAGGGAGCAGGCGGT GGG Intronic
900151301 1:1180380-1180402 GGGCCCCGGGAGCAGGCGGTGGG - Intronic
900431995 1:2606856-2606878 GAGAGCAGCCAGCTGGGGGTGGG + Intronic
900538099 1:3188825-3188847 GAGAGGAGGAAGCAGGGGGCGGG + Intronic
900576322 1:3384249-3384271 GAGGGCAGGGGGCAGGGGATGGG - Intronic
900646853 1:3712944-3712966 CAGAGCTGGGAGCAGAGGGTGGG - Intronic
901048604 1:6414468-6414490 GGCAGCAGGGAGCAGGGGCTCGG - Intronic
901134765 1:6986068-6986090 GACGGCAGGGAGCAGCCAGTGGG - Intronic
901513574 1:9730581-9730603 GAGAGCAGCGAGGAGGAGGAGGG - Exonic
902380080 1:16048659-16048681 GAGAGCCTGGAGGAGGGGGTGGG + Intronic
902546522 1:17193849-17193871 GAGAGCAGGAGGCAGGAGGTGGG + Intergenic
902583897 1:17426317-17426339 GTGAGAAGGGAGCAGGAGGTGGG - Intronic
902784249 1:18722719-18722741 GCCAGCAGGGAGCAGGAGGGAGG + Intronic
903701968 1:25255926-25255948 CACAGCAGGAGGCAGGCGGTGGG - Intronic
903806477 1:26009332-26009354 GAGGGCAGGAAGAAGGCAGTGGG + Intergenic
904253448 1:29240056-29240078 GAGAGGAGACAGCAGGCTGTGGG - Intronic
904376268 1:30084348-30084370 CAGAGGAGGGAGCAGAAGGTGGG + Intergenic
904646655 1:31972594-31972616 AAGAGCAGTGAGGAGGCTGTTGG + Intergenic
904706496 1:32394748-32394770 GAGAGCTGGGAGCAGAGGGGAGG + Intergenic
904956172 1:34285679-34285701 GAGAGCAGGATACAGGAGGTTGG - Intergenic
905448928 1:38045111-38045133 GGGGGCAGAGAGCAGGCGGCGGG + Exonic
908539879 1:65112185-65112207 GAGAGCAGGAACAAGGGGGTGGG + Intergenic
910807911 1:91206819-91206841 CAGAGCAGGTAGCAGGCAATCGG + Intergenic
912411655 1:109484260-109484282 GCGAGCGGTGAGCAGGCGCTAGG - Intronic
912449124 1:109758773-109758795 GAGACCAGGGAGCAGGGGGTGGG - Intronic
912552052 1:110490735-110490757 GAGAGCAGGAGGCAGGGGCTGGG + Intergenic
912949853 1:114113130-114113152 GAGTGTGGGGAGCAGGAGGTGGG - Intronic
912953201 1:114134794-114134816 GAGAGATGGGAGCTGGCTGTTGG + Intronic
915147240 1:153802413-153802435 GGGAGCATGGAGCAGGAGGAGGG + Intergenic
915956483 1:160224591-160224613 AAAAGCAGGGACCAGGAGGTGGG + Intronic
916212810 1:162372557-162372579 TAGAGAAGGGAGCATGGGGTTGG + Intronic
917628919 1:176874045-176874067 GGGAGTAGGCAGCAGGTGGTGGG - Intronic
918282906 1:183023388-183023410 GGGAGGAAGGAGCAGGGGGTGGG - Intergenic
919593861 1:199537823-199537845 GAGATCAAGGTGCAGGGGGTGGG + Intergenic
919730856 1:200912856-200912878 GAGGCCAGGGAGCAGGCTGGAGG + Intronic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
920098096 1:203499706-203499728 GAGGGCATGTAGCAGGCGGAAGG - Exonic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920261982 1:204694548-204694570 GAGAGCAGGAAGTAGGCAGCAGG - Intergenic
920377959 1:205519405-205519427 GTGACAGGGGAGCAGGCGGTGGG - Intronic
920418451 1:205813643-205813665 GGGAGGAGGGAGCACGCGGCTGG - Intronic
920834585 1:209497893-209497915 GAGAGCAGGCAGCAGGTGCCAGG + Intergenic
921529675 1:216265898-216265920 GATAGCAGGGAGAAGGGGATAGG + Intronic
922006016 1:221531464-221531486 GAGAGAAGAGAGCAGGGGGAGGG - Intergenic
922467005 1:225851229-225851251 GAGGGCAGGGATCAGCCGGGTGG - Intronic
922748647 1:228060674-228060696 GAGGGCAGGGAGGAGGGGCTGGG - Exonic
922996150 1:229963175-229963197 GAGAGCAGGGTGCTGGGTGTGGG + Intergenic
923118578 1:230968565-230968587 TAGAGCAGGGGGCAGGTGGGAGG + Intronic
924325139 1:242888277-242888299 GAGAGCTGGTGGCAGGCAGTAGG - Intergenic
924561205 1:245156969-245156991 GAGAGCTGGGAGGGGGCGGCAGG - Intronic
1062930337 10:1348577-1348599 GAGAGCAGGGCACAAGGGGTAGG - Intronic
1063366414 10:5493614-5493636 GAGAGGAGGGGGCAGGAGGGAGG - Intergenic
1063866952 10:10374935-10374957 GAGAACAGGTAGCGGGTGGTTGG + Intergenic
1063956565 10:11273032-11273054 GAGAGCGGGGAAGAGGGGGTGGG - Intronic
1064162215 10:12956429-12956451 GGGAGCAGGGAGCAGCCATTAGG - Intronic
1064224342 10:13469307-13469329 GACTGCAGGGAGCAGTCAGTGGG + Intronic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1064326108 10:14353115-14353137 GAGAGAAGGGAGAGGGCTGTGGG + Intronic
1064342503 10:14499742-14499764 GAGAAGTGGGACCAGGCGGTGGG - Intergenic
1064565757 10:16637298-16637320 GACAGGAGGGATCAGGAGGTTGG + Intronic
1067523505 10:47025369-47025391 GAGAGCAGGGCACAGGCAGCAGG - Intergenic
1069548482 10:69345696-69345718 GAGAGCAGGGCCCAGTGGGTAGG - Intronic
1069562717 10:69442034-69442056 GAGAGCAGGGGACAGGAGGAAGG + Intergenic
1069821256 10:71230074-71230096 AAGAGCAGAGAGGAGGAGGTAGG - Intronic
1069893206 10:71664812-71664834 GAGAGAAGGGAGGAGGGGGAAGG - Intronic
1069898323 10:71692635-71692657 CTGAGCAGGGAGCTGGGGGTGGG - Intronic
1070862762 10:79685667-79685689 GAGAGCAGGGACTAGTGGGTAGG + Intergenic
1070942056 10:80356826-80356848 GTGAGCAGAGGGCACGCGGTGGG + Intronic
1070963888 10:80517832-80517854 GAGGGCAGGGAGCGGAGGGTGGG - Intronic
1071717827 10:88114774-88114796 GAGGGCAGGGGGCAGGCAGGTGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1072723467 10:97796062-97796084 GAGAGCAGGGCGCTGGGAGTGGG - Intergenic
1072750438 10:97974963-97974985 GGGAGAAGGGAGCGGGCAGTGGG + Intronic
1073444189 10:103571138-103571160 GGGAGCAGGAAGCAGGAGGCGGG - Intronic
1073615662 10:104992139-104992161 TAGGGGAGGGAGCAGGGGGTAGG + Intronic
1074469280 10:113712581-113712603 GGGAGCTGGGAGCAGACAGTAGG - Intronic
1074545999 10:114403203-114403225 GACAGCAGGGAGCCGGCGTGGGG - Intronic
1075046328 10:119149320-119149342 GAGAGCAGGGGCCGGGTGGTAGG - Intronic
1075054574 10:119207766-119207788 GAGAGCAGGAATAATGCGGTAGG + Exonic
1076631397 10:131854300-131854322 GAGAGAAGGGAGAAGGCAGAAGG - Intergenic
1076650823 10:131986079-131986101 GACAGCAGGGAGCAGGCAGTTGG + Intergenic
1076858108 10:133127355-133127377 GGGAGCTGGGAGCAGCGGGTGGG + Intronic
1076879009 10:133230942-133230964 GGGAACGCGGAGCAGGCGGTCGG - Intronic
1076888850 10:133274408-133274430 GAGGGTAGGGGGCAGGGGGTGGG + Intronic
1076921693 10:133457636-133457658 GAGGGCAGGGAGAAGGGGGGTGG + Intergenic
1076930326 10:133528025-133528047 GTCAGCACGGAGCAGGCGCTGGG + Intronic
1077060203 11:614539-614561 GAGAGAATGGGGCAGGCGTTAGG + Intronic
1077181861 11:1220441-1220463 GAGGGCAGGGGACAGGCAGTGGG + Intergenic
1077227425 11:1444543-1444565 GAGAGCAGGGAGCAGCCAGGAGG - Intronic
1077315384 11:1917376-1917398 GGGAGTGGGGAGCAGGCTGTGGG - Intergenic
1077364063 11:2154504-2154526 GGAAGGAGGGAGCAGGCGGCTGG - Intronic
1078266427 11:9758836-9758858 GAGAGAAGGGAGGAGACGGGAGG - Intergenic
1079121418 11:17688011-17688033 GTGAGCAGTGAGCAGGCGGTGGG - Intergenic
1080221842 11:29914861-29914883 GAGAGTATGTAGCAGGTGGTGGG - Intergenic
1080824284 11:35834872-35834894 GACAGCAGTGAGCAGGGGGAAGG - Intergenic
1081992160 11:47343653-47343675 GGGAGCAGGGTGCGGGCGGTGGG - Intronic
1081997578 11:47375227-47375249 GAGAACAGAGAGGAGGAGGTGGG + Intronic
1081999164 11:47383561-47383583 GAGAGCAGGGCGAAGGCAGATGG + Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1082784281 11:57308506-57308528 GAGGCCAGGGAGCTGGGGGTTGG - Exonic
1083424291 11:62575145-62575167 GAGATCAGGGAACAGGCCTTGGG + Exonic
1084419952 11:69055393-69055415 GAGAGCAGCGGCCAGGCGCTGGG - Intronic
1084435903 11:69139535-69139557 AGGAGCAGGCAGCAGGCGGAAGG + Intergenic
1084659883 11:70540461-70540483 GCGGGCAGGGAGGAGGTGGTAGG - Intronic
1085195653 11:74670179-74670201 GAGAGTGGGGAGCAGAGGGTTGG - Intergenic
1085348856 11:75785421-75785443 GATAGCAGGGAGCAGGCCTCGGG - Intronic
1085383202 11:76139242-76139264 GAGAGCAGGGAGCTGGGGCCAGG + Intronic
1085395508 11:76205289-76205311 GACAGCAGGGGGCAGGTTGTGGG - Intronic
1085744420 11:79102509-79102531 GGGAGCAGGGACAAGGCTGTGGG - Intronic
1086415943 11:86588971-86588993 GAGTGCATGGAGCAGGCCCTGGG - Intronic
1087236738 11:95727706-95727728 GAAAGCAGGGGGCAGGAGGCAGG + Intergenic
1087264575 11:96046134-96046156 GAGAGAGGGGAGCAGGCAGGGGG + Intronic
1088277301 11:108101446-108101468 GAGAGCAGGGAAGAGGCCATGGG - Intronic
1089455568 11:118623568-118623590 GAGACCAGGGAGCATGCAGAGGG + Intronic
1089690701 11:120185155-120185177 GAGAGCAGAGAGCATAGGGTGGG - Intronic
1089781131 11:120874037-120874059 GAGGCCGGGGAGCAGGCGGAGGG - Intronic
1090253658 11:125268148-125268170 GAGAGCAGGGAGGGGCAGGTGGG - Intronic
1090415098 11:126535099-126535121 CAGAGCTGGGAGCAGGCAGATGG + Intronic
1090665956 11:128914992-128915014 GAGAGCAGAGAGCAGGCTGTGGG + Intronic
1091324698 11:134677484-134677506 GAGAGGAGGGAACAGGAGGTTGG - Intergenic
1091409292 12:228688-228710 GAAAGGAGGGAGCAAGGGGTAGG - Intronic
1091837476 12:3595851-3595873 GAGAGCAGGGTGCGGGTGGCTGG + Intergenic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1092104228 12:5909747-5909769 GTGCCCAGAGAGCAGGCGGTGGG + Intronic
1092203755 12:6603348-6603370 GAGAGGAGGGAGGAGGGAGTCGG - Intronic
1092218401 12:6697713-6697735 AAGAGCCCTGAGCAGGCGGTGGG + Exonic
1092588516 12:9925839-9925861 GTCAACAGGGAGCAGGTGGTCGG - Intronic
1093624826 12:21332608-21332630 CAGTGCTGGGAGCAGGGGGTGGG + Intronic
1095957896 12:47817170-47817192 GAGAGCAGTGAGCTGGGGGTGGG - Intronic
1095999782 12:48119465-48119487 ATGGGCCGGGAGCAGGCGGTAGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096587380 12:52631595-52631617 GAGAGCAGGGAGGACTGGGTCGG - Intergenic
1096633402 12:52943987-52944009 GTGAGCAGGGAGCAGAAGGCTGG + Intronic
1096826136 12:54279670-54279692 GTGAGCAGGAAGCGCGCGGTAGG - Intronic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1100354896 12:93819724-93819746 GAGGGCAGGGAGCTGACTGTGGG + Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1101883381 12:108641150-108641172 CAAAACAGGGAACAGGCGGTTGG + Intergenic
1101966646 12:109286740-109286762 GACAGCTGGGGGCAGGAGGTGGG + Exonic
1101973585 12:109335299-109335321 CAGAGCAGGGAGCAGGTGTGGGG + Intergenic
1102577166 12:113863066-113863088 GAGAGAAGGGAGGAGGGGGGAGG + Intronic
1102756149 12:115342534-115342556 GAGAGCAGGGAGGAGGGAGAAGG + Intergenic
1102868165 12:116390930-116390952 GAGAGCAGAGAGCTGGCACTTGG + Intergenic
1102977979 12:117220282-117220304 GAGAGCAGTGAGAAGGGGCTGGG + Intronic
1103363609 12:120368155-120368177 GCGAGCCGGGAGCAGGAGGAGGG + Intronic
1103783341 12:123414147-123414169 GACACCATGGAGCAGGGGGTGGG + Exonic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104042085 12:125137099-125137121 GATAGCAGGGAGAAGCCAGTTGG - Intronic
1104384857 12:128341920-128341942 GACAGCAGGAAGCAGGGGGTGGG - Intronic
1104843161 12:131834272-131834294 GGGAGGAGGGAGGAGGCGGGAGG - Intronic
1104886281 12:132110828-132110850 GGGAGCAGGATGCAGGCTGTGGG + Intronic
1104934667 12:132358057-132358079 GAGAGCTGGGTGCAGGCGGCAGG + Intergenic
1105820663 13:24078070-24078092 GAGAGCAGGCATCAAGTGGTGGG - Intronic
1106122318 13:26870841-26870863 GGGAGCAGGGAACAGACGGGTGG - Intergenic
1106473514 13:30078198-30078220 GAGTGCAGTGAGCACGTGGTAGG + Intergenic
1106545883 13:30731005-30731027 GAGCGCTGGGAGCAGGGGATGGG + Intronic
1107428282 13:40316082-40316104 GAGCTCTGGGAGCAGACGGTGGG - Intergenic
1108594261 13:51936441-51936463 GGGGGCAGGGAGCAGGGGGCGGG + Intronic
1110370748 13:74737586-74737608 AAGGGAAGGGAGCAGGTGGTGGG + Intergenic
1110450765 13:75636030-75636052 GAGGGCAGGGGCCAGGCGGGCGG + Intronic
1111705761 13:91747526-91747548 TGGAGCAGGAAGCAGGCAGTGGG - Intronic
1112033142 13:95475206-95475228 GGGAGCAGGCAGCAGGGGGCAGG - Intronic
1112538880 13:100286455-100286477 CAGAGCAGGTAGCAGGTGATCGG + Intronic
1112716276 13:102189853-102189875 GAGAGCAGGGAGGAGGTGCCAGG + Intronic
1113119036 13:106906620-106906642 GGCAGCAGGGAGCAGGCGGCGGG + Intergenic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113614182 13:111669537-111669559 GGGGGCAGGGGGCAGGCGGCCGG - Intronic
1113619650 13:111754451-111754473 GGGGGCAGGGGGCAGGCGGCCGG - Intergenic
1113735373 13:112674774-112674796 GAGAGGTGGGAGCAGGTGGGAGG + Intronic
1113849841 13:113411878-113411900 GACAGCAGGGAGCAGGGGAGTGG - Intergenic
1113885874 13:113658162-113658184 GGGTGCAGGGAGCAGACGGGAGG - Exonic
1113890138 13:113731336-113731358 GAGAGAAGGTAGGAGGCGGCCGG + Exonic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114656750 14:24320517-24320539 GAGAGCAGGGAGCAGGCGGTGGG + Intronic
1114889757 14:26904055-26904077 GGGAGCAGAGAGCAGGTGCTTGG + Intergenic
1115519696 14:34221127-34221149 GAGAGCAGAGAGCAAGAGGAGGG + Intronic
1117014905 14:51508234-51508256 GAGAGGAGGGAGCACTCCGTGGG - Intronic
1117367889 14:55049697-55049719 TAGAGAAGGGAGCAGAAGGTGGG + Intergenic
1117392049 14:55271620-55271642 GAGCGCAGGCAGGCGGCGGTAGG - Intronic
1117776532 14:59189409-59189431 GAGAGCAGGGTGTTGGCGGCCGG + Intronic
1119644130 14:76336412-76336434 GAGAGCAGGCAGCAGATGGCTGG + Intronic
1119660479 14:76447840-76447862 GAGAACAGGTAGGAAGCGGTGGG - Intronic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1121441776 14:93954122-93954144 GAGAGGTGGCAGCAGGGGGTGGG + Intronic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1122366818 14:101199242-101199264 GGGGGCAGGGGGCAGGGGGTGGG + Intergenic
1122403381 14:101480905-101480927 GGGAGCAGGGAGCAGGGAGCTGG + Intergenic
1122606246 14:102948691-102948713 GTGAGGGGGGAGCAGGGGGTGGG + Intronic
1122931005 14:104933109-104933131 GAAATCAGAGAGCAGGCGGGCGG - Exonic
1122952099 14:105050742-105050764 GAGAGCATGTGGCAGGCAGTGGG - Exonic
1122967551 14:105138381-105138403 CAGAGCAGGGAGCAAAGGGTCGG - Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124217384 15:27818676-27818698 GAGACCATGGAGGAGGCTGTTGG + Intronic
1124911135 15:33921920-33921942 AAGAGCAGGGAGCGGAGGGTGGG + Intronic
1125201901 15:37107386-37107408 GAAAGCAGGGAGGAGACTGTTGG - Intergenic
1125685080 15:41559185-41559207 GAGGGCGGGGAGGAGGCGGCGGG - Exonic
1127399531 15:58572531-58572553 GAGGGCAGGGAGCAGCAGGGAGG - Intergenic
1127969462 15:63947062-63947084 GCGGGCAGGGAGTAGGAGGTGGG - Intronic
1128349311 15:66878304-66878326 GACAGGGGGGAGCAGGCCGTGGG + Intergenic
1128397926 15:67247899-67247921 GAGTGCAGGTAGCAAGCAGTAGG - Intronic
1128779764 15:70351672-70351694 GAGGGCAGTGAGCAGGAGCTCGG - Intergenic
1129266457 15:74395988-74396010 GAGACCGGAGGGCAGGCGGTGGG - Intergenic
1129333511 15:74839542-74839564 GCGAGCAGTGAGCAGACGGCTGG - Exonic
1129740855 15:77988882-77988904 GGGAGCAGGGAGCAAGTGCTTGG + Intronic
1130256957 15:82330182-82330204 GGGAGCAGGGAGCAAGTGCTTGG + Intergenic
1130532952 15:84761378-84761400 AAGAGCAAGGACCAGGGGGTCGG + Intronic
1130597991 15:85259806-85259828 GGGAGCAGGGAGCAAGTGCTTGG - Intergenic
1130958665 15:88645255-88645277 GAGACCAGGGAGGAGGCACTAGG - Intronic
1132482858 16:175251-175273 CAGGGCAGGGAGCAGGCTGAAGG + Intergenic
1132989194 16:2784480-2784502 GAGAGGAGGCAGGAGGTGGTGGG + Exonic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133973748 16:10585355-10585377 GATAACAGGAAGCAGGGGGTGGG + Intergenic
1134082548 16:11335118-11335140 GAGAGAAGGGAGGAGGTGCTGGG + Intronic
1134112399 16:11523859-11523881 AGGAGCAGGGAGCAGGTGGGTGG - Intergenic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1135735839 16:24931212-24931234 GAGAGCTGGGAGGGGGCGGAGGG + Exonic
1135994365 16:27237252-27237274 GAGAGCAGGCATCAGGAGGGAGG + Intronic
1137765351 16:50973638-50973660 GAGAGCAGGGAGGTGGTGATGGG + Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1138215915 16:55205174-55205196 GAGAGAAGTCAGCAGGAGGTTGG - Intergenic
1138605591 16:58086306-58086328 GAGGGCAGGGAAATGGCGGTGGG + Intergenic
1139287759 16:65830729-65830751 GCGAGCAGGGAGGAAGAGGTGGG - Intergenic
1139908115 16:70380565-70380587 GAGAGCAGGGTGGAGGCAGGCGG + Exonic
1139954664 16:70687310-70687332 GAGTGCAGGGACCAGGCCCTGGG + Intergenic
1141127920 16:81414388-81414410 GAGACCAGGCAGAAGGAGGTTGG - Intergenic
1141425302 16:83940888-83940910 GGTAGCAGGGAGCAGGGGGCAGG + Intronic
1141590450 16:85065315-85065337 GAGAGCAAGGAGTGGCCGGTCGG - Intronic
1141625644 16:85259724-85259746 GGAAGCAGAGAGCAGGTGGTGGG - Intergenic
1141647800 16:85376767-85376789 GAGAGCAGGGGGCTGGGGCTGGG + Intergenic
1141662531 16:85449112-85449134 GGGAGCAGGGAGCAGCTGGCCGG + Intergenic
1141694929 16:85614623-85614645 GAGGGCAGCGTGCTGGCGGTGGG + Intronic
1141699724 16:85636791-85636813 TGGAGCAGGGAGCTGGCGTTGGG + Intronic
1141704216 16:85655778-85655800 GGGGGCAGGGAGCCGGGGGTGGG - Exonic
1141778429 16:86140223-86140245 GACAGCAGTGAGCAGGGGGTAGG + Intergenic
1141888697 16:86911511-86911533 GGGAGCAGGAAGCAGGAAGTAGG - Intergenic
1142071058 16:88091486-88091508 GGGAGCTGGGACCAGGTGGTGGG + Intronic
1142265686 16:89063086-89063108 GAGAGCGGGGCGCCGGCGGTGGG - Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142610979 17:1109130-1109152 GGGAGGAGGGAGGAGGCGGGCGG + Intronic
1142894263 17:2964127-2964149 GAGAGGAGGTACCAGGCGGTAGG + Intronic
1142986456 17:3697943-3697965 GAGAGCAGGGACCATGCCTTTGG + Intergenic
1143155541 17:4833802-4833824 GAGAGAAGGGAGCAGAGGGCGGG - Intronic
1143292118 17:5839163-5839185 GAGAGCAGGGGGAATGGGGTTGG + Intronic
1143483410 17:7239487-7239509 AGGAGGAGGGAGCAGGCGGCCGG - Exonic
1143513482 17:7408120-7408142 GAAAGGAGGGAGGAGGGGGTTGG - Intronic
1143562932 17:7705801-7705823 GTGGGCAGGGAGGAGGCGGGAGG + Intronic
1143681292 17:8477777-8477799 GAGGGCAGGGAGCGGGAGGGAGG + Intronic
1143705938 17:8697704-8697726 GGGAGCAGGGAGCTGGGGGCGGG + Intergenic
1143712537 17:8744431-8744453 GAGAGGAGGGGACAGACGGTTGG + Intronic
1143714229 17:8755670-8755692 GAGAGAAGGGAACAGGGGCTGGG + Intronic
1144761723 17:17710998-17711020 GAGAGAAGGGAGCAGGGGAGGGG - Intronic
1144884918 17:18451334-18451356 GGGAGCAGGGAGGAGGGGGCTGG - Intergenic
1144998475 17:19287231-19287253 GGGAACAGGGGGCAGGTGGTGGG - Intronic
1145147305 17:20493043-20493065 GGGAGCAGGGAGGAGGGGGCTGG + Intergenic
1145243613 17:21253346-21253368 GGGCGCAGGCGGCAGGCGGTGGG + Exonic
1146310728 17:31766334-31766356 GAGAGCAGGGTACAGGGGTTGGG - Intergenic
1146561107 17:33871425-33871447 ATGAGCAGGGAGAAGGAGGTGGG - Intronic
1146790056 17:35745964-35745986 GCGAGCAGGGGGCAGCCGGATGG + Exonic
1147200907 17:38800196-38800218 GAGAACAGGCAGCAGGTGGGTGG - Intergenic
1147591926 17:41689248-41689270 GACCGGAAGGAGCAGGCGGTAGG + Intronic
1147684731 17:42280317-42280339 GAGAGAGGGGAGGAGGCTGTAGG - Intergenic
1147882403 17:43662681-43662703 GGGGGCAGGGAGCAGGTGGGAGG - Intergenic
1148546957 17:48526463-48526485 GAAAGCAGGGAGGAGGAGGAAGG - Intergenic
1148743715 17:49907216-49907238 GGGTGCAGGGAGGAGGCGGGTGG - Intergenic
1148746702 17:49922370-49922392 GAGGTCAGGGAGCAGGGAGTAGG - Intergenic
1149978176 17:61287326-61287348 GAGAGGAGGAAGCCTGCGGTAGG + Intronic
1150245383 17:63670820-63670842 GAGAGCTGGGAGCAAGGGGAAGG + Intronic
1150522348 17:65882178-65882200 GGGAGCAGGCAGCAGGCAGAAGG - Intronic
1151327381 17:73387720-73387742 GAGAGCTGGGGGCAGGCTGGAGG + Intronic
1151328329 17:73392174-73392196 GAGAGAATGGGGCAGGGGGTGGG + Intronic
1151664036 17:75535365-75535387 GAGAGCAGGCAGCTGGCGCTGGG + Intronic
1151714680 17:75825293-75825315 GAGAGCTGGGGGCAGCTGGTTGG - Exonic
1152023575 17:77794713-77794735 GGGAGCAGGCAGCGGGCAGTGGG + Intergenic
1152078905 17:78174583-78174605 GAGAGGAGGGAGCATGCGGCAGG + Exonic
1152100558 17:78299412-78299434 AAGAGCACGGACCAGGAGGTAGG - Intergenic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152664138 17:81557670-81557692 GAGAGCAGACAGCCCGCGGTGGG + Exonic
1152926289 17:83089225-83089247 AAGAACAGGGAGCAGTGGGTAGG - Intronic
1152970647 18:158425-158447 GAGAGGAGGGAGGAGGGGGAAGG - Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1156454124 18:37283274-37283296 GAGAGCAGACAGCAGGGGCTTGG - Intronic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157128034 18:44976198-44976220 TGGAGCAGGAAGCAGGCGGCAGG + Intronic
1158558610 18:58495346-58495368 GAGGCCAGGGAGCAGGAGCTGGG - Intronic
1159049323 18:63403964-63403986 GTGAGCAGGAAGCAGGTGTTAGG + Intronic
1160010400 18:75103012-75103034 GACACCAGGGAGCAGGCTCTGGG + Intergenic
1160025984 18:75216787-75216809 GAGAGCAGGGAGGAGGGCCTGGG + Intronic
1160824829 19:1074674-1074696 CACAGCATGGTGCAGGCGGTGGG + Exonic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1160941416 19:1622023-1622045 CAGGGCAGGGGGCAGGGGGTGGG - Intronic
1160968449 19:1756922-1756944 GAGAGGAGGCAGGAGGTGGTGGG - Intronic
1161118651 19:2513045-2513067 GAGAGCTGGGTGCCGGGGGTGGG + Exonic
1161327587 19:3671071-3671093 GAGGGCAGGAAGCCAGCGGTGGG + Intronic
1161366080 19:3880624-3880646 GTGTGCAGGGAGGAGGGGGTGGG - Exonic
1161415806 19:4145686-4145708 GGGAGCAGGGAGGAGGAGGAAGG + Intergenic
1162059506 19:8086094-8086116 GAGTGAAGGGGGCAGGCAGTGGG + Intronic
1162063452 19:8110796-8110818 GAGAGGAGAGAGCAGGAGTTGGG - Intronic
1162723649 19:12676830-12676852 GTGAGCTGGGAGCAGGGGTTTGG - Intronic
1162744942 19:12792878-12792900 GGGTCCAGGGAGCAGGCGGTGGG + Exonic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163756253 19:19108051-19108073 GAGAGCTGGGAGCATGAGGAGGG + Intronic
1164171303 19:22727963-22727985 GAGAGCAGGGACCAGGCAGGAGG - Intergenic
1164728813 19:30485677-30485699 GAACTCAGGAAGCAGGCGGTGGG + Intronic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165324951 19:35109076-35109098 GAGACCAGGGAGGAGGCTCTGGG + Intergenic
1165492887 19:36135348-36135370 GACAGCAGGGAGCAGACAGAAGG + Intergenic
1165492891 19:36135362-36135384 GACAGAAGGGAGCAGGCTGTGGG + Intergenic
1165673982 19:37705824-37705846 GAGAGAAGGGAGCAGGGGTGGGG - Intronic
1166082361 19:40452036-40452058 GAGACCAGGGAGTAGGCTGCTGG - Intronic
1166305927 19:41937075-41937097 GGGAGCAGGGAGCAAGCGCGAGG + Intergenic
1166700598 19:44879460-44879482 GAGGGCATGGGGCAGGCGGGGGG + Intronic
1166862081 19:45816585-45816607 GAGAGCAGGAAGGGGGCGCTGGG + Intronic
1167232883 19:48296632-48296654 GAGAGCCGGAAACAGGAGGTGGG + Exonic
1167307394 19:48716910-48716932 GCTGGCAGGGAGCAGGCGGGAGG - Intronic
1167355762 19:49003153-49003175 GGGAGTAGGGAGCAGGGGTTGGG - Intronic
1167455284 19:49594564-49594586 GAGAGGAGAGAGGAGGCGGAGGG - Exonic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167578604 19:50329328-50329350 GAGAGCAGGGAGGAGGGGCGGGG + Exonic
925181997 2:1823444-1823466 TGGAGGAGGGAGCAGGCAGTGGG + Intronic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926082867 2:10002988-10003010 GAGAGCAGGGAGTGGGTGCTGGG - Intergenic
926337385 2:11874993-11875015 GAGAGAGGGGAGCGGACGGTGGG - Intergenic
927907620 2:26872179-26872201 GAGAGCAGGGAGCATGAGTCTGG + Intronic
927934676 2:27069663-27069685 GAGAGCAGTGAGCTGGAGCTGGG + Exonic
928194178 2:29202501-29202523 GAGAGCAGAGAGAGGGAGGTGGG - Intronic
928231252 2:29500621-29500643 GAAAGCAGGGAGCAGGGAGGAGG - Intronic
929056844 2:37885688-37885710 GAGGGTAGGGAGGAGGAGGTTGG - Intergenic
929231308 2:39563339-39563361 GAAAGCAGTGGGCAGGGGGTTGG - Intergenic
929583237 2:43097734-43097756 GAGAGCAGGGAGTGGGAAGTTGG + Intergenic
929806852 2:45153838-45153860 AGGAGCAGTGGGCAGGCGGTTGG - Intergenic
929934422 2:46284279-46284301 GAGAGCAAAAAGCAGGCAGTGGG + Intergenic
929992657 2:46802827-46802849 TAGAGCAGAAAGCAGGAGGTCGG - Intergenic
931680979 2:64750193-64750215 GAGGGCAGGGATCAGGTTGTGGG - Intronic
931770216 2:65490964-65490986 GAGAGCAGGGCTCAGGGGTTTGG + Intergenic
931785390 2:65613436-65613458 GAGAACAGACAGCAGGCTGTAGG + Intergenic
932144746 2:69307265-69307287 GAGATCAGGGAGCGGGCAGAGGG + Intergenic
932270007 2:70401071-70401093 GACAGCAGGAAGCAGGATGTGGG - Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
933335592 2:80954597-80954619 GGAAGCAGGGAGTAGGAGGTGGG + Intergenic
933536704 2:83584584-83584606 GGCAGCAGGCAGCAGGTGGTGGG - Intergenic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
934990249 2:98915409-98915431 CAGGGCAGGGAGCAGGCCATGGG + Intronic
935364121 2:102271328-102271350 GAGAGCAGAGTGCACGTGGTTGG - Intergenic
935444551 2:103142138-103142160 GAAAGCAGGGAAGAGGCTGTTGG - Intergenic
935659725 2:105455849-105455871 GAGAGCAGAGACCTGGCTGTTGG + Intergenic
935945134 2:108279270-108279292 GAGGGCTGGGAGCAGGAGGCTGG + Intergenic
936302600 2:111315625-111315647 GAGGCCGGGGAGCAGGCGCTGGG + Intergenic
936542529 2:113363795-113363817 AAGTGCAGGGAGCAGGTGGGAGG - Intergenic
936924619 2:117723600-117723622 GAGAGAAGGGAGCAGGAGAAAGG + Intergenic
937412841 2:121691333-121691355 GAGAGGAGGGAGCTGGAGTTGGG - Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
938068563 2:128294608-128294630 GAGAGCTGGGAGAAGAAGGTGGG + Intronic
938310516 2:130285883-130285905 TAGAGAAGGGAGCAGGTGGTCGG - Intergenic
938323384 2:130380714-130380736 GAGAGCAGGGTGCAAGTGGGAGG + Intergenic
938398204 2:130965870-130965892 GAGAGTTGGGAGCAGGGGGTGGG + Intronic
938444411 2:131366484-131366506 TAGAGAAGGGAGCAGGTGGTCGG + Intergenic
938766723 2:134464657-134464679 GAGGAGTGGGAGCAGGCGGTGGG + Intronic
939605813 2:144253951-144253973 CACAGCAGGGAGCAGGAGTTTGG - Intronic
941052499 2:160750283-160750305 GAGAGCTGGGATCAGGAGCTGGG + Intergenic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941686977 2:168456868-168456890 GAGAGCAGGGCCCAGGAGGAGGG - Intronic
942947216 2:181683891-181683913 GAAAGCGGGGAGCGGGAGGTCGG + Intergenic
943181413 2:184547347-184547369 GACAACAGGAAGCAGGTGGTTGG - Intergenic
943494157 2:188598732-188598754 GAGGGGAGGGAGTAGGCAGTTGG - Intergenic
944490625 2:200254657-200254679 GAGACCAGGGAGCAGGCAGATGG - Intergenic
946186015 2:217980776-217980798 CAGAGCAGGGAGCATGCTGGAGG - Intronic
946236501 2:218327517-218327539 GAGAGCAGAGAGCAGCAGGGAGG - Intronic
946308553 2:218870319-218870341 GAGAGCAGGAAGAAGGAGCTGGG - Intronic
946433731 2:219638874-219638896 GAGAGATGGGAGGAGGAGGTGGG + Intronic
946587041 2:221201317-221201339 TAGAGCAGGGAACAGGAGATGGG + Intergenic
946601129 2:221361506-221361528 GAGAGCAGGAAGAACGAGGTGGG + Intergenic
946926155 2:224629320-224629342 GAGAGTAGGTAGCGGGGGGTGGG - Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947407154 2:229790521-229790543 GGGGGCAGGGAGCAGGGGGAGGG + Intronic
947793984 2:232882945-232882967 GGCAGCAGGGAGCAGGAGGATGG + Intronic
948025129 2:234770637-234770659 GAAAGCAGAGTGCAGGCTGTGGG - Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948901068 2:240957166-240957188 GAGGGCAGAGAGCTGGGGGTTGG - Intronic
949035936 2:241815777-241815799 GAGAGCGGAGGGCAGGCGGGGGG - Intronic
949044014 2:241862373-241862395 GTGAGGAAGGAGCAGGCGGTGGG - Intergenic
1169206057 20:3740920-3740942 CAGAGCAGGGACCAGGTGGTGGG + Intronic
1169226080 20:3857838-3857860 GAGGCCAGGGAGCAGGCTGGGGG - Intronic
1170298149 20:14852125-14852147 GAGGGATGGGAGCAGGCGGGAGG + Intronic
1170937803 20:20824987-20825009 CAGAGCAGGGAGCAGGCCCTGGG - Intergenic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1172187496 20:33040213-33040235 GGAAGCAGGGAGAAGGCAGTGGG - Intronic
1172764328 20:37343132-37343154 GAGGGCAGGGTGGAGGGGGTAGG - Intergenic
1172997809 20:39083813-39083835 GGGAAAAGGGAGCAGGTGGTTGG - Intergenic
1173201302 20:40957203-40957225 GAGAGAAGGGAGAAAGGGGTAGG + Intergenic
1173441664 20:43082916-43082938 GTCAGCAGGAAGCAGGTGGTCGG - Intronic
1173540412 20:43846900-43846922 GAGAGCGGGGAGCTGGGGATGGG + Intergenic
1173748115 20:45453530-45453552 GAGAGGAGGGGGTAGGAGGTAGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173880004 20:46405445-46405467 GAGAGCACTGAGCAAGCGGACGG + Intronic
1173880280 20:46406565-46406587 GAGACCCGGGAGCAGGAGCTGGG - Exonic
1174036882 20:47673952-47673974 TGGAGCGGGGAGCAGGCAGTGGG - Intronic
1174258553 20:49277417-49277439 GGGGGCAGGGAGCAGGCTGAAGG + Intronic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174499700 20:50975651-50975673 GGGTGCAGTGTGCAGGCGGTGGG - Intergenic
1174499711 20:50975694-50975716 GGGTGCAGTGTGCAGGCGGTGGG - Intergenic
1174499733 20:50975786-50975808 GAGTGTAGTGTGCAGGCGGTGGG - Intergenic
1174567390 20:51475394-51475416 GCGAGCAGGGGGCAGGTGGCAGG - Intronic
1174835108 20:53849620-53849642 GAGGACAGGGAGGTGGCGGTGGG + Intergenic
1175661498 20:60816835-60816857 GGGAGCAGGGAGCCGGAGGGGGG + Intergenic
1175723877 20:61303703-61303725 GGGAGCAGGGAGGAGGAGGTAGG + Intronic
1175946232 20:62560129-62560151 CAGAGCAGGGGGCAGGCTGGGGG - Intronic
1176193230 20:63824000-63824022 GAGTGCAGAGAGGAGGCTGTAGG + Intronic
1176198300 20:63847986-63848008 GAGAGGAGGGAGCTGGGGGCTGG + Intergenic
1177942046 21:27423217-27423239 GAAAGCAGGGAAAAGGAGGTAGG - Intergenic
1178584727 21:33862506-33862528 GAGGGCATGGAGCAGATGGTGGG + Intronic
1180110356 21:45644365-45644387 GAGAGCCGCGCGCGGGCGGTGGG + Intronic
1181363381 22:22355629-22355651 GTGGGCAGGGAGGAGGCCGTGGG + Intergenic
1181366266 22:22379074-22379096 GTGGGCAGGGAGGAGGCCGTGGG + Intergenic
1181404391 22:22672438-22672460 TGGAGCAGGGTGCAGGAGGTGGG + Intergenic
1181530220 22:23513106-23513128 GAGAGCAAGTGGCAGGGGGTGGG - Intergenic
1181726653 22:24815784-24815806 GTCAGCAGGAAGCAGGTGGTGGG + Intronic
1182353322 22:29710929-29710951 GAGTGCAGGGAGCTGGAGGTGGG - Intergenic
1182434441 22:30321330-30321352 GAGAGCATGGAGCTGGCATTGGG - Intronic
1182527832 22:30932671-30932693 GAGGGCGGGGAGGAGGAGGTGGG - Exonic
1182554313 22:31120798-31120820 GAGCTCAGGGAGCGGGTGGTGGG + Intergenic
1183404715 22:37624796-37624818 GAGACCAGGGAGGTGGCGGAGGG + Intronic
1183713503 22:39520447-39520469 GAGGGAAGGGAGCGGGCGGGAGG + Intronic
1183736703 22:39648482-39648504 GGGAGCAGTGAGCCGGCGCTGGG + Intronic
1184427838 22:44423572-44423594 GAGAGCAGGAAGCAGGGGCTAGG + Intergenic
1184482166 22:44754079-44754101 GAGGGCAGGGACCAGGCAGCTGG - Intronic
1184663322 22:45975595-45975617 GAGAGGTGGAAGCAGGCGCTGGG - Intronic
1184717379 22:46289742-46289764 GAGAGCAGGCAGCCCGCGGTGGG + Intronic
1184869105 22:47222293-47222315 CACAGCAGGGAGCACGCTGTGGG - Intergenic
1184932232 22:47690052-47690074 GAGATAAGGAAGCAGGGGGTCGG + Intergenic
1185100696 22:48839391-48839413 GAGGGCACAGAGCAGGCGCTGGG + Intronic
1185384468 22:50525518-50525540 GAGCGCAGGGAGCTGGAGGTCGG - Intronic
949397570 3:3631198-3631220 GATAGCAGGGACCAGGGGGGAGG - Intergenic
949988194 3:9555705-9555727 GAGGGCAGGGAGCAGGGAGGTGG + Intergenic
950203478 3:11060979-11061001 GAGAGCGGGGCGCGGGCAGTAGG + Intergenic
950404581 3:12796795-12796817 GAGAGAAGGGGGCCGGCGGCGGG - Intronic
950806963 3:15613485-15613507 GAGAGAAGGGAGAAGGGAGTGGG - Intronic
952283868 3:31948963-31948985 GAGAAAAGGGAGCAGGTGTTTGG + Intronic
952453241 3:33450500-33450522 GAGAGCAGGGTATAGGGGGTTGG - Intergenic
952788081 3:37176008-37176030 GGGAGCAGGGAGCGGGGAGTTGG - Intronic
952883686 3:38000409-38000431 GAGGGAAGGGAGGAGGAGGTGGG + Intronic
953544934 3:43857514-43857536 AGGAGCAGGCAGCAGGAGGTGGG - Intergenic
954143223 3:48621105-48621127 GGGAGCAGGGAGTAGGGTGTGGG + Intronic
954604792 3:51900937-51900959 TAGAGGAAGGTGCAGGCGGTGGG - Intronic
954806268 3:53222713-53222735 GAGAGGAGGGTGAAGGCTGTTGG - Intergenic
956669260 3:71671241-71671263 GAGAGCAGAGAACAGGCTTTGGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
961182167 3:124886325-124886347 GCGAGGAGGAAGCAGGCGGGGGG + Intronic
961326705 3:126113302-126113324 GTAAGCATGGAGCAGGCGGTGGG + Intronic
961589983 3:127971641-127971663 GAGCTCAGGGAGCAGGCTGAGGG + Intronic
962298873 3:134219210-134219232 GAGAGCAGGTAGGAGGGGCTCGG - Intronic
962626698 3:137232402-137232424 GAGAGCAGGGAACAGGCTGGAGG + Intergenic
962783893 3:138748316-138748338 GGCAGCAGGGAGCTGGAGGTGGG - Intronic
963003885 3:140707959-140707981 GAGAGCATGGGGTAGGGGGTGGG - Intergenic
963004329 3:140711885-140711907 GGGGCCAGGGAGAAGGCGGTTGG - Intergenic
963011003 3:140770451-140770473 CAGAGCAGGGAGCATGTGCTGGG - Intergenic
963259108 3:143176198-143176220 GAGAGCCGGGGGCAGACGGGCGG + Intergenic
964697888 3:159530408-159530430 GAGGGTAGGGAGAAGGCTGTTGG - Intronic
967972868 3:195012214-195012236 GGGGGCAGGGAGCAGGCAGCTGG - Intergenic
968107138 3:196009273-196009295 GAGGGCAGGGGGCAGGGTGTGGG - Intergenic
968221630 3:196944202-196944224 GAGAGCAGGGGGTTGGGGGTGGG - Intergenic
968263604 3:197344637-197344659 GGGAGCAGGGAGAAGTCGTTTGG - Intergenic
968632926 4:1661515-1661537 GACAGCAGCCAGGAGGCGGTAGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969411257 4:7029867-7029889 CAGAGGAGGGAGCAGGCTCTGGG + Intronic
969431054 4:7154538-7154560 GAGAGCACAGAGCAGAGGGTGGG + Intergenic
969486775 4:7476753-7476775 GAGAGCGTGGAGCAGGTGCTGGG - Intronic
969520708 4:7676264-7676286 GAGGGCAGAGGGCAGGGGGTCGG - Intronic
969665977 4:8557883-8557905 GGGAGCTGGGAGCAGGCTGGAGG - Intergenic
969835496 4:9836769-9836791 GAGAGGATGCAGCAGGCTGTTGG + Intronic
970092555 4:12426887-12426909 AAGAGGAAGGTGCAGGCGGTGGG + Intergenic
970855555 4:20646810-20646832 TATAGCAGGGAGCAGGGTGTAGG - Intergenic
971143314 4:23948334-23948356 GAAAGGAGGGAGCAGGAGGGAGG + Intergenic
971267961 4:25111339-25111361 GAGAGCAGGGAGCTGGATTTGGG + Intergenic
971381193 4:26099609-26099631 GAGAGCAGAGAAGAGGCTGTTGG - Intergenic
972197021 4:36665840-36665862 GAGAGGAGGGAGCAGGGAGTGGG + Intergenic
972488674 4:39566137-39566159 TAGAACAGGGAGGAGGCAGTGGG + Intronic
973589239 4:52424012-52424034 GAGAGCTGGAACCAGGTGGTTGG + Intergenic
974677191 4:65107669-65107691 GATAGGAGGGAGTAGGAGGTTGG + Intergenic
975116622 4:70687914-70687936 GTGAGCAGGGAGAGGGCGATGGG + Intergenic
977177233 4:93832264-93832286 GGGAGAAGCGAGCAGGCGGCTGG + Intergenic
978370946 4:108029172-108029194 GAGAGGAGGGAGCAGGTGGTGGG - Intronic
979273566 4:118791522-118791544 GAGAGGAGGGAGGAGGGAGTAGG - Intronic
979621540 4:122804070-122804092 GAGAGCAGGCAGCAGAAGGGTGG + Intergenic
979623183 4:122818501-122818523 GATAGCATGGGGCAGGGGGTGGG + Intergenic
979666168 4:123313181-123313203 GGGAGGAGGGAGGAGGCAGTAGG - Intronic
981924496 4:150123373-150123395 GAGATGAGGGAGCAGCTGGTTGG + Intronic
983650778 4:170034467-170034489 CAGAACAGGGAGCTGGCGCTAGG - Intergenic
983834743 4:172373327-172373349 GAGAGCAGGGAATAGGGGTTGGG + Intronic
984379017 4:178966555-178966577 GAGAGCAGTTTGCAGGTGGTGGG + Intergenic
985279028 4:188269032-188269054 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279044 4:188269082-188269104 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279060 4:188269132-188269154 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279076 4:188269182-188269204 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279092 4:188269232-188269254 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279108 4:188269282-188269304 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279124 4:188269332-188269354 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279140 4:188269382-188269404 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279156 4:188269432-188269454 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279172 4:188269482-188269504 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279188 4:188269532-188269554 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279204 4:188269582-188269604 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279220 4:188269632-188269654 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279236 4:188269682-188269704 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279252 4:188269732-188269754 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279268 4:188269782-188269804 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985774549 5:1833977-1833999 GAGAAGAGGGAGCAGCCGGGAGG - Intergenic
985806122 5:2044708-2044730 GAGAGCTGGGAGGTGGCGGGAGG - Intergenic
985812891 5:2103267-2103289 GAGAGCAGGGGGGTGGCGGGAGG - Intergenic
985994856 5:3592260-3592282 GAGCGCAGGGGGCAGGCTGTGGG - Intergenic
986136312 5:4982359-4982381 GTGTGCAGGGGGCAGGCGGGGGG + Intergenic
986445357 5:7816368-7816390 GAGAGCAGGGAGGAGGCTTGGGG - Intronic
986450390 5:7857676-7857698 GAGATTAGTGAGCAGGCGATGGG - Intronic
986822499 5:11482874-11482896 GAGAGCAGGGGGCAAGGAGTTGG + Intronic
986856640 5:11876197-11876219 GAGAGGAGGGAGGAGGCAGGAGG + Intronic
988872564 5:35406839-35406861 GAGAGCAGTGTGCAGTCAGTAGG - Intergenic
989200331 5:38756814-38756836 GAGATCAGGGAGCCGGGGGGTGG - Intergenic
990801358 5:59607644-59607666 TAGAGGAGGCAGCAGGGGGTAGG + Intronic
990879420 5:60522760-60522782 GAGAGCAGGCAGCAGGCATGGGG - Intergenic
992068166 5:73126079-73126101 GAGAGCAGGTTGCAGGGTGTGGG + Intronic
992781578 5:80132906-80132928 AAGAGCAGTGAGAAGGCTGTTGG + Intronic
993030015 5:82695014-82695036 GAGGGTGGGGAGCAGGCAGTGGG - Intergenic
994710364 5:103258605-103258627 GAGAGCTGGGCGCAGGAGGCGGG + Intergenic
997980161 5:138464006-138464028 GGGAGAAGGAAGCAGGGGGTGGG - Intergenic
998099468 5:139419972-139419994 GAGAGGAGGGATCAGGAGGCTGG + Intronic
998599880 5:143574797-143574819 GAGACCAGGGAGGAGGCTGTTGG - Intergenic
999252009 5:150188386-150188408 GCGAGCAGGGATGAGGCAGTTGG - Intergenic
999992675 5:157063705-157063727 AAGAGCAGGGTGAAGGTGGTTGG + Intergenic
1001116846 5:168947418-168947440 GAGAGCAGTGAGCAGGGGCCTGG - Intronic
1001335234 5:170791180-170791202 GAGAACAGGGAGCCTGGGGTAGG + Intronic
1001537155 5:172506091-172506113 GAGAGCAGGGAGCGTGGGGAGGG - Intergenic
1001925982 5:175637556-175637578 TAGGGCAGGGTGCAGGGGGTAGG - Intergenic
1002074969 5:176703039-176703061 GGGAACAGGCAGCAGGGGGTGGG - Intergenic
1002108405 5:176891680-176891702 CAGAGCTGGGTGCAGGCTGTTGG - Intronic
1002928963 6:1620490-1620512 GGGAGCCGGGAGTAGGCGGTGGG + Intergenic
1003138709 6:3454625-3454647 GAAAGCAGGGGGTAGGAGGTGGG + Intronic
1005083154 6:21977631-21977653 GAGAGCCCGGAGCAAGTGGTAGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1006334066 6:33411243-33411265 GGGGGCAGGGAGCCGGGGGTCGG + Intronic
1006440918 6:34053265-34053287 GAGAGCTGGGAGCAGGGGCAGGG - Intronic
1006598213 6:35208958-35208980 GAGAGAAGGGAGCAGGCGATAGG + Intergenic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1007094036 6:39202444-39202466 GAGGGCAGGGGGCAGGAGCTGGG + Intronic
1007380827 6:41488967-41488989 AGGAGCAGGGACCAGGTGGTGGG + Intergenic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1007770112 6:44185504-44185526 CAGAGCAGGTAGCAGGTGATTGG - Intergenic
1010249183 6:73691064-73691086 GAAAGCAGAGAGCAGGTGGGTGG - Intergenic
1012930321 6:105309670-105309692 GAGAGCAAGGAGCTGGTGCTTGG + Intronic
1012977531 6:105796059-105796081 GAGAGCAGGGAGCCAGGGGAAGG + Intergenic
1013815262 6:114090427-114090449 GGGAGGAGGGAGGAGGGGGTAGG - Intronic
1014141868 6:117953000-117953022 GAGAGAAGTGAGCAGGAAGTGGG + Intronic
1017011356 6:150065857-150065879 GACAGAAGGGAGCAGACTGTGGG - Intronic
1017720039 6:157237416-157237438 GAGAGCAGGGGCCAGGTGGCAGG - Intergenic
1017809950 6:157977443-157977465 GGCAGAAGGGAGCAGGCAGTGGG - Intergenic
1017993061 6:159506737-159506759 GAAAGCAGGGAGCAAGAGGCAGG - Intergenic
1018205800 6:161436174-161436196 GAGGGCAGAGAGCAGGGGGCAGG + Intronic
1018205808 6:161436201-161436223 GAGGGCAGAGAGCAGAGGGTGGG + Intronic
1019227799 6:170529579-170529601 GAGAGAAGGGAGCAGGGGACTGG - Intergenic
1019388641 7:773083-773105 GTGACCATGGAGCAGGCGCTGGG + Intronic
1019494735 7:1332447-1332469 GAGACCAGGGAGCTAGGGGTGGG - Intergenic
1019610226 7:1932961-1932983 GAAAGCAGTGAGCAGGGGGAAGG - Intronic
1019738042 7:2660086-2660108 GAGTGCAGGGTGGAGGCGGGAGG - Intronic
1020020601 7:4865109-4865131 GAGAGCAGTGGGCAGTCGGTGGG - Intronic
1021141675 7:17033492-17033514 GAGAGGTGGGAACAGGTGGTGGG + Intergenic
1022016112 7:26349937-26349959 TGGAGGAGGGAGCAGGCGCTTGG - Intronic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022569948 7:31442529-31442551 GAGAGCAGAGAGGAGACGGAGGG + Intergenic
1022597061 7:31722771-31722793 GAGTGCAGGAAGCAGGGGGATGG + Intergenic
1023057596 7:36302451-36302473 GAGAGCAGGGAGAATGCCGTGGG - Intergenic
1023165019 7:37335286-37335308 GAGAGCTGGGAGAAGGCAGGGGG + Intronic
1023551057 7:41370054-41370076 GTGAGGAGGGACCAGGGGGTGGG + Intergenic
1024818426 7:53298045-53298067 GAGGTCAGGGAGGAGGCCGTGGG - Intergenic
1024864481 7:53888907-53888929 GTCAACAGGGAGCAGGTGGTCGG + Intergenic
1025253543 7:57367807-57367829 GAGAGCAGGGGGGAGGCAGTAGG + Intergenic
1026791716 7:73337110-73337132 GAGAGCAGGGTTCAGGCGTGAGG + Intronic
1026847028 7:73704132-73704154 GAGATCAGTGAGCTGGGGGTGGG - Exonic
1028288332 7:89032711-89032733 GACATCAGGGAGTAGGAGGTAGG + Intronic
1029238424 7:99142774-99142796 GAGGGGAGGGAGCAGGTGGGAGG + Intronic
1029459962 7:100688725-100688747 GAGAGCAGGGGGGAGGAGGGAGG + Exonic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029640448 7:101816499-101816521 GGGAGCGGGGAGCGGGCGGCGGG + Intronic
1029987065 7:104931795-104931817 GAGCGCAGGGGGTAGGGGGTGGG + Intergenic
1030376038 7:108754807-108754829 GAGACCAGGGAGTAGGCTGTTGG + Intergenic
1032516589 7:132510666-132510688 GAGGGCAAGGAGCAGGCTGCAGG + Intronic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1034900581 7:154905830-154905852 GGGAGCAGGGATCAGGAGGGAGG + Intergenic
1034953017 7:155313702-155313724 AAGGACAGGGAACAGGCGGTAGG - Intergenic
1035609159 8:948747-948769 GTGAGCAGGGCTCAGGCCGTGGG + Intergenic
1036135855 8:6160980-6161002 GGGAGAGGGGAGCAGGAGGTGGG - Intergenic
1036609045 8:10334096-10334118 GAAAGCAGGCAGTAGGCGCTGGG - Intronic
1036815220 8:11897259-11897281 GAGGGCAGGGTGCAGGGGGGCGG + Intergenic
1036846384 8:12173394-12173416 GACAGCCTGGAGCAGGCCGTGGG + Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1038398204 8:27262492-27262514 GCGATCAGGGAGCAGGTGGAGGG + Intergenic
1038421010 8:27434063-27434085 GAGAGGAGGAAGGAGGAGGTTGG - Intronic
1039048504 8:33472283-33472305 GGGAGCAGGGGGCAGGCTGTTGG + Intronic
1040493523 8:47946585-47946607 GAGTGCAGAGACCAGGCGGAGGG - Intronic
1042560608 8:70070334-70070356 GGGAGCCGAGCGCAGGCGGTCGG + Intronic
1042893756 8:73642903-73642925 AACAGCAGGGAGCAGCAGGTGGG + Intronic
1044632531 8:94293182-94293204 GACAGCAGGGAGCAGGGAGCAGG + Intergenic
1044632534 8:94293189-94293211 GGGAGCAGGGAGCAGGGGCAAGG + Intergenic
1045583137 8:103500509-103500531 GACTGGAGGGAGCAGGCGGGAGG - Intergenic
1046946480 8:119978941-119978963 GGGAGCAGGGAGCAGGGAGAGGG - Intronic
1046946483 8:119978948-119978970 GGGAGCAGGGAGCAGGGAGCAGG - Intronic
1046946485 8:119978955-119978977 GTGAGCAGGGAGCAGGGAGCAGG - Intronic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1049748763 8:144273862-144273884 GGCAGCAGCGAGCAGGCGGAGGG - Intronic
1049804136 8:144531301-144531323 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804161 8:144531419-144531441 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804187 8:144531537-144531559 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804201 8:144531596-144531618 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804215 8:144531655-144531677 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804228 8:144531714-144531736 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804242 8:144531773-144531795 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804268 8:144531891-144531913 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804282 8:144531950-144531972 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804295 8:144532009-144532031 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804308 8:144532068-144532090 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1051894631 9:21974835-21974857 GAGAGCAGGCAGCGGGCGGCGGG - Exonic
1053416891 9:37952438-37952460 GTGAGCAGCGGGCAGGAGGTAGG + Intronic
1056300304 9:85233358-85233380 GAGAGCAGGAAGGAGGCGCTGGG + Intergenic
1057909303 9:99005373-99005395 GGGATCAGGCAGCAGGCGGCAGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058740212 9:107935329-107935351 GACAGCAGGGAGCAGGAGGATGG + Intergenic
1059591610 9:115668452-115668474 GTGAGAAGGCAGCAGGCTGTAGG + Intergenic
1060027604 9:120186148-120186170 GAGAGCAGGGAGCATGTTTTGGG + Intergenic
1060232831 9:121838350-121838372 GAGACCAGCGAGGAGGCTGTGGG - Intronic
1060550443 9:124482462-124482484 GAGAGCTGGGAGCAGGGAGGGGG + Exonic
1060882748 9:127129792-127129814 GAGGGAAGAGAGAAGGCGGTGGG - Intronic
1061128116 9:128689452-128689474 GAGCGCCGGGAGGAGGCGGCCGG + Intronic
1061178146 9:129009514-129009536 GATGGCAGGGACCAGGGGGTGGG - Intronic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061281692 9:129601367-129601389 GAGAGGAGGGAGGAGGCAGAGGG + Intergenic
1061374482 9:130215907-130215929 GAGAAGAGGGAGCAGGATGTGGG - Intronic
1061613785 9:131765944-131765966 CAGGGCTGGGAGCAGGAGGTCGG - Intergenic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062187808 9:135227939-135227961 GAGAGCAGCGTGCAGGCAGAGGG + Intergenic
1062209118 9:135353683-135353705 GGGAGCAGTGAGCAGGAGGGAGG + Intergenic
1062469637 9:136696878-136696900 GAGGGCAGGGAGGAGGGGGAGGG - Intergenic
1062622257 9:137428390-137428412 GTGGGCAGGGAGCAGGCAGGGGG + Intronic
1062695228 9:137871780-137871802 CAGAGCAGAGAGCAGACAGTTGG + Intergenic
1185456720 X:314411-314433 GGGAGCCGGGGGCAGGCAGTGGG + Intronic
1185581336 X:1213178-1213200 GAGGGGAGGGAGGAGGGGGTGGG - Intergenic
1185581507 X:1213604-1213626 GAGGGGAGGGAGGAGGGGGTGGG - Intergenic
1185852805 X:3504857-3504879 GGGAGCAGGGGGTAGGCGGGGGG + Intergenic
1186289355 X:8079907-8079929 GAGAGCAGGTAGGAGGTGATTGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1190708215 X:53048336-53048358 GAGGCCAGGGAGCAGCCGGCTGG - Intergenic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1195360992 X:104084022-104084044 GGGAGCAGGGAGCAGGGAGCAGG + Intergenic
1195906369 X:109848538-109848560 GAGACCAGAGACCAGGTGGTTGG - Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1196844617 X:119888344-119888366 GAGAGCTGGGAGGAGCAGGTGGG - Intergenic
1197100215 X:122644460-122644482 ACGTGCATGGAGCAGGCGGTGGG - Intergenic
1197898522 X:131342977-131342999 GTTGGCAGGGAGCAGGGGGTAGG + Intronic
1198048638 X:132927406-132927428 GAGAGCAGTGAGAAGGCATTGGG - Intronic
1198162316 X:134019820-134019842 GAGAGCACAGAGTAGGAGGTTGG - Intergenic
1198243127 X:134803716-134803738 TTGAGCAGGGAGTAGGAGGTGGG - Intronic
1198293031 X:135257198-135257220 TAGAGCAAGAAGCAGGCTGTTGG + Intronic
1198546951 X:137702333-137702355 GAAAGCGGGGAGCAGGTGGCCGG - Intergenic
1199987336 X:152962179-152962201 GTGAGCAGGGGGCAGGAGCTGGG + Intronic
1200073992 X:153542270-153542292 GGCAGCCGGGAGGAGGCGGTGGG + Intronic
1200100584 X:153687772-153687794 GAGGGCAGGGAGGAGGTGGGCGG + Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1201222667 Y:11787293-11787315 GAGAGCTGGTGGCAGGCAGTAGG - Intergenic