ID: 1114657353

View in Genome Browser
Species Human (GRCh38)
Location 14:24324077-24324099
Sequence CATGGCAAAGACAAGGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 1, 2: 1, 3: 49, 4: 462}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114657349_1114657353 -7 Left 1114657349 14:24324061-24324083 CCAGGCTGGTAATGGCCATGGCA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657344_1114657353 6 Left 1114657344 14:24324048-24324070 CCCTCTGTCCTCACCAGGCTGGT 0: 1
1: 1
2: 3
3: 58
4: 351
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657341_1114657353 8 Left 1114657341 14:24324046-24324068 CCCCCTCTGTCCTCACCAGGCTG 0: 1
1: 4
2: 5
3: 71
4: 556
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657339_1114657353 28 Left 1114657339 14:24324026-24324048 CCTCATGGGGGTGGATAGGGCCC 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657345_1114657353 5 Left 1114657345 14:24324049-24324071 CCTCTGTCCTCACCAGGCTGGTA 0: 1
1: 0
2: 5
3: 22
4: 263
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657347_1114657353 -2 Left 1114657347 14:24324056-24324078 CCTCACCAGGCTGGTAATGGCCA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657342_1114657353 7 Left 1114657342 14:24324047-24324069 CCCCTCTGTCCTCACCAGGCTGG 0: 1
1: 0
2: 10
3: 55
4: 533
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462
1114657338_1114657353 29 Left 1114657338 14:24324025-24324047 CCCTCATGGGGGTGGATAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG 0: 1
1: 1
2: 1
3: 49
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114657353 Original CRISPR CATGGCAAAGACAAGGAGGA TGG Exonic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901276987 1:7999581-7999603 CAAGGTCAAGGCAAGGAGGATGG - Intergenic
903657081 1:24956098-24956120 CAGGGCAGAGCCAAGGAGGCAGG + Intronic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904439255 1:30519205-30519227 GATGGAAAAGATGAGGAGGATGG + Intergenic
906720084 1:47997734-47997756 CCTGGCGAAGGGAAGGAGGAGGG - Intergenic
907196956 1:52694861-52694883 CATGGCTGAACCAAGGAGGAGGG + Intronic
907520154 1:55018561-55018583 CAGGGCTATGACAAGGAGGAAGG + Intergenic
907702728 1:56804991-56805013 CCAGGCAAAGAAAAGCAGGAAGG - Intronic
907711907 1:56891197-56891219 GATGCCAAAGACAAGGGTGAAGG + Intronic
909499407 1:76317226-76317248 CATGGCACAGACATGGTGGTAGG - Intronic
909574821 1:77161944-77161966 TATGGCATAGACAAGGAAGAGGG - Intronic
909906660 1:81204319-81204341 TATGGCAAAGACCCGGAGGAGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910081427 1:83347153-83347175 CATGGACATGACAAAGAGGAGGG + Intergenic
910171328 1:84380454-84380476 CATATCTAAGACAAGAAGGAAGG + Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
913272890 1:117111470-117111492 CATGGCATAGAGACGGAGTAGGG + Exonic
913445281 1:118944271-118944293 GATGGCCAAGAAAAGGAGGGTGG + Intronic
913452957 1:119004541-119004563 CCTGGCAGAGACATGGGGGAGGG + Intergenic
914666335 1:149835860-149835882 GAGGGCAGAGGCAAGGAGGAGGG + Intergenic
914669432 1:149857938-149857960 GAGGGCAGAGGCAAGGAGGAGGG - Intronic
915929340 1:160049433-160049455 ATAGGTAAAGACAAGGAGGAAGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916351681 1:163857007-163857029 CATTTCAAAGAAAAGTAGGAAGG + Intergenic
916685172 1:167137686-167137708 AATGGCAAAGAGCTGGAGGAGGG + Intergenic
916890319 1:169106836-169106858 CGCGGGAAAGCCAAGGAGGAGGG + Exonic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917695902 1:177523746-177523768 GATGGGAAAGACAAAGAGTAAGG + Intergenic
917931331 1:179824660-179824682 CAAGGCAAAGCCCAGGAGGGCGG - Intergenic
917983501 1:180290620-180290642 CACTGCAAAGGCAGGGAGGAAGG + Intronic
918248170 1:182679044-182679066 CATGGGAAAGAATAGGTGGAAGG - Intronic
918283539 1:183029268-183029290 TAAGGCAGAGACAAAGAGGACGG - Intronic
918550166 1:185733742-185733764 CGTAGAAAGGACAAGGAGGAGGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
919582978 1:199400517-199400539 TATGACAAAGAAAAAGAGGAAGG - Intergenic
919911351 1:202112920-202112942 CAGGGCAGAGCCAAAGAGGAGGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920129300 1:203719317-203719339 CAAGGCAAAGGCAATGAGGGTGG - Intronic
920523742 1:206649675-206649697 CATGGGAGAGGAAAGGAGGAGGG - Intronic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
923494480 1:234512537-234512559 GCTGGCAAAGATAAGGAGAAAGG - Intergenic
1063584284 10:7337458-7337480 CATGACAAGACCAAGGAGGATGG - Intronic
1063956855 10:11275183-11275205 GAGGGCAAAGACAAGAAGCAGGG + Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067179345 10:43973160-43973182 CATGGCAGAGGCCAGGTGGATGG - Intergenic
1067473373 10:46551356-46551378 CAAGGCTAGGCCAAGGAGGATGG - Intronic
1068214321 10:53964046-53964068 CTTGGCAAAGCCAAGGAGGCAGG - Intronic
1068432163 10:56947887-56947909 CATGGGAAAGACTGGGAGCAAGG - Intergenic
1068953439 10:62801285-62801307 CATGGCAGAGACAAGGTTTAGGG - Intergenic
1069102159 10:64335378-64335400 CAAGGCAAGGAAAAGGAGAAGGG + Intergenic
1069344957 10:67457939-67457961 CATGGCAAAGGGAATTAGGATGG - Intronic
1069561391 10:69432972-69432994 CATGGCGAAGAGGATGAGGAAGG + Intergenic
1070046688 10:72845167-72845189 CATTGTAAAGCCAAGGAGAAAGG + Intronic
1070215446 10:74374640-74374662 CATGACAATGACAAGCAGGCTGG - Intronic
1071476594 10:86030904-86030926 GCTGGCAAAGAGAAGGAAGATGG - Intronic
1072000695 10:91193108-91193130 CATGGCAAACGCAAGAAGGAAGG + Intronic
1072525669 10:96269510-96269532 CATGGCAGTGAGAAGGAAGAGGG - Intronic
1073826714 10:107332222-107332244 CATGGGGAAGGGAAGGAGGAAGG - Intergenic
1074212261 10:111346419-111346441 CATGGCATGGACAGGGAGTAAGG + Intergenic
1074558020 10:114509721-114509743 CATGGCCAAGGCATGGATGAGGG - Intronic
1074609016 10:115003701-115003723 CATAGCAAAAACTAGAAGGAAGG + Intergenic
1074840757 10:117348557-117348579 CATCGCCAAGCCAAGGAGAAAGG - Intronic
1077733700 11:4765218-4765240 CATGGCAGAGAAACTGAGGAAGG + Intronic
1077795628 11:5488846-5488868 CATGGCAATGACCAGGATGAGGG - Exonic
1077875249 11:6299151-6299173 CATGGCAAAGGAAGGAAGGAAGG + Intergenic
1079345870 11:19651837-19651859 CATAGCAAAGACAGGGCAGATGG + Intronic
1080075126 11:28139570-28139592 CATGGCACAGACAAGGTCTAGGG - Intronic
1080097303 11:28424452-28424474 TATGACAAAGACAGGTAGGAGGG + Intergenic
1080396274 11:31893165-31893187 CATGGCAAAGGCAAAGAAAATGG - Intronic
1081341875 11:41938012-41938034 CATGTCAAAGACAGGGAAAATGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082721374 11:56681054-56681076 CATGGCAAAGTTGAAGAGGAAGG - Intergenic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083627951 11:64081589-64081611 CAGGCCAAAGACAGGGAGCAAGG + Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084914641 11:72419398-72419420 CCTGGCACATACAAGCAGGAAGG + Intronic
1085029369 11:73260330-73260352 CTCTGCAAAGACAAAGAGGATGG - Intergenic
1085835271 11:79949300-79949322 CATGGCAAGGAAAATGATGATGG + Intergenic
1085937236 11:81162332-81162354 GATGGCAAAGAGAAGGAGAGTGG + Intergenic
1086431448 11:86740605-86740627 CATGTCTAAGAGAAGAAGGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088232080 11:107683494-107683516 CATTTCAAAGCCAAGGATGAGGG + Intergenic
1088551631 11:111019364-111019386 CAGGTCAAAGACAGTGAGGAAGG - Intergenic
1088715397 11:112544379-112544401 AATGGCAATGAGAGGGAGGAAGG + Intergenic
1088788142 11:113201049-113201071 GATGGAAAAGGGAAGGAGGAGGG - Intronic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1089359366 11:117875996-117876018 GATGGATAAGACAAGAAGGAGGG + Intronic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1091267555 11:134282630-134282652 CAAGGCAAAGAAAAGCAAGAGGG - Intronic
1091842300 12:3629835-3629857 CAAGGAAAAGACAAGGGGGGGGG + Intronic
1092064876 12:5581684-5581706 CATGGCGAGGGGAAGGAGGAGGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092675324 12:10911305-10911327 CATGACAAAGACATAGAGAATGG + Intronic
1092759172 12:11793795-11793817 CATGGCAAAGAAAGCCAGGAAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093592966 12:20928379-20928401 CAAAGCAAAGTCAAAGAGGAGGG - Intergenic
1094525753 12:31229578-31229600 CCTGGCAGAGACAGTGAGGAGGG + Intergenic
1095128175 12:38506952-38506974 CATGTGAAAGACAAGGGGCAGGG - Intergenic
1096737242 12:53665317-53665339 CATGGCAAAGAGGATGAGAAAGG + Exonic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097249889 12:57626687-57626709 CCTGGCAGGGACAAGGAGGCAGG + Exonic
1098214414 12:68200407-68200429 CTTGGCAAAGCCAGGGAGCAGGG + Intergenic
1098306398 12:69107017-69107039 CATGGCAAGAAGAAGCAGGAAGG - Intergenic
1099195710 12:79613088-79613110 CATGGCAGAGAGAAAGAGGGAGG - Intronic
1099345771 12:81497980-81498002 AAAGACACAGACAAGGAGGAGGG + Intronic
1100659652 12:96682958-96682980 CAAGGGAAAGACAAGGAAAATGG - Intronic
1101091287 12:101288591-101288613 CATGGTCATGACAAGGAGGCTGG - Intronic
1101240597 12:102834456-102834478 CTTGGGAAAGCCAAGGAGGCAGG - Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1102911641 12:116719417-116719439 AATTTCAAAGACAGGGAGGAGGG + Intronic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1104234289 12:126918009-126918031 CTTAGCAAAGACAAGGATGTAGG - Intergenic
1105206366 13:18228904-18228926 CATGACAAAGAAAAGGAGGCCGG + Intergenic
1105633485 13:22195011-22195033 TAAGCCAAAGATAAGGAGGAAGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106563186 13:30863996-30864018 CCTGGCAAAGGAAAGGAGGGAGG - Intergenic
1108092099 13:46859633-46859655 CATGGCCCAGAGCAGGAGGAAGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108765064 13:53618558-53618580 CATGGACAGGACAAAGAGGAAGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1110076087 13:71244913-71244935 TAAGGAAAAGAAAAGGAGGAAGG - Intergenic
1110136448 13:72073366-72073388 CCTGGCAAAAATAAGGAAGAAGG + Intergenic
1110283834 13:73726444-73726466 CTTGCCAAGGACTAGGAGGAAGG - Intronic
1110492602 13:76126524-76126546 GATGGCAAGGACATGGAGAAGGG + Intergenic
1110952337 13:81512170-81512192 CATATAAAAGACAAGGAGGGAGG - Intergenic
1113095947 13:106663822-106663844 CATGACAAAGAGGATGAGGAAGG - Intergenic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1113899102 13:113786282-113786304 AATGGCAATGACAGCGAGGATGG - Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1116572001 14:46530335-46530357 CCTGACAAAGACAAGGAATAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117118848 14:52547282-52547304 CAGGGCAAAGCCAAGGACCACGG + Intronic
1117490220 14:56239882-56239904 GATAGAAATGACAAGGAGGATGG + Intronic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119964029 14:78893098-78893120 GATGGCAAAGAAAAGGAAGGTGG - Intronic
1120602419 14:86527848-86527870 CATTCACAAGACAAGGAGGATGG + Intergenic
1121120957 14:91375663-91375685 CATGGCCAAGCCAAGCAGGATGG + Intronic
1121242574 14:92440905-92440927 CCAGGCAAAGGCAGGGAGGAGGG + Intronic
1122059345 14:99126193-99126215 CATGGAAAATCCATGGAGGATGG + Intergenic
1122064270 14:99160500-99160522 CATGGCAATCACAAGTAGAAAGG + Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122278067 14:100605397-100605419 AATGGCAGAGACAAGCAGCAAGG - Intergenic
1122577843 14:102752877-102752899 TCTGGGAAAGACTAGGAGGAAGG - Intergenic
1122667130 14:103338377-103338399 AAGGGCAAAGACAAGGAAAATGG + Exonic
1123988387 15:25665198-25665220 CAGGGCAAAGACAAGGACCAAGG + Intergenic
1124691855 15:31829944-31829966 CATGAGAAAGACAAAGAGAAGGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1126142057 15:45446872-45446894 TATGGGAAGGACAAGAAGGACGG - Intronic
1126724965 15:51622698-51622720 CATGGCAGGGACGAGGCGGAGGG - Intronic
1127535640 15:59887411-59887433 CATGGCAAAAACCAGTTGGACGG + Intergenic
1127886730 15:63207946-63207968 CATGGCAAAGTCCAGGAGAGAGG - Intronic
1129026380 15:72578150-72578172 TATGGCAAAGAAAACGTGGAAGG - Intronic
1129265577 15:74391588-74391610 CTTGGCAAAGTCATGGAGGCAGG - Intergenic
1129521078 15:76186653-76186675 CATGCCAGAGACAAGTAGGTAGG - Intronic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1134175169 16:12000029-12000051 GAAGGCTAGGACAAGGAGGATGG + Intronic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1137060422 16:35788219-35788241 CATGGGAAACACAAGCAGGCTGG + Intergenic
1138241916 16:55434256-55434278 CATGGCCAAGAAGAGCAGGAAGG + Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1138955213 16:61963244-61963266 CATGGAAGGGACATGGAGGAAGG - Intronic
1139703747 16:68726155-68726177 CATGGCAGAGGCAGGGAGGCTGG - Intergenic
1142026815 16:87818828-87818850 CATGGCAGAGACACGCAGGCTGG - Intergenic
1142254679 16:89007990-89008012 CCTGGCAAAGATGAGGTGGATGG - Intergenic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1144616741 17:16782950-16782972 CCTGAAAAAGACAAGGAGAATGG - Intronic
1144895950 17:18532711-18532733 CCTGAAAAAGACAAGGAGAATGG + Intergenic
1144965496 17:19074968-19074990 AGTGGGAATGACAAGGAGGAAGG - Intergenic
1144982471 17:19177215-19177237 AGTGGGAATGACAAGGAGGAAGG + Intergenic
1144985752 17:19201024-19201046 AGTGGGAATGACAAGGAGGAAGG - Intergenic
1145136263 17:20411509-20411531 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1146282728 17:31555635-31555657 CAGGGGAAAGGCAAGCAGGAAGG - Intergenic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146538188 17:33671521-33671543 TATGGGAAAGACAAGGAAGGAGG + Intronic
1146678981 17:34793456-34793478 GAAGGCAAAGCCAAGGAGGCTGG + Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1147791161 17:43015123-43015145 CATGGCACAGACCACGATGAGGG + Exonic
1148601248 17:48895744-48895766 CATGGCGAAGAGGATGAGGAAGG - Exonic
1149016518 17:51914642-51914664 CATGGCAAAGAGAAGGAAATTGG + Intronic
1149186683 17:54006315-54006337 CATGACAGAGAAAAGAAGGAAGG - Intergenic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1151405603 17:73884227-73884249 GATGCCAGAGACAAGGAGGCCGG - Intergenic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1154381321 18:13852385-13852407 CATGGCATAGGCATGCAGGATGG + Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155662138 18:28262099-28262121 CATGGAAAAGACAAGAAGATTGG - Intergenic
1156486784 18:37471490-37471512 AGGGGCAAAGGCAAGGAGGAGGG - Intronic
1156801551 18:41120960-41120982 AATGACAAACACCAGGAGGAAGG + Intergenic
1156863445 18:41864431-41864453 CATAGCCAGGACAAAGAGGAAGG - Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1158082893 18:53615422-53615444 CATGGCTAATACAGGGAGGAAGG - Intergenic
1158890448 18:61867151-61867173 CATGGCAAATACAAAGAGATTGG + Intronic
1159625086 18:70683677-70683699 AATGTCAAAGAGAGGGAGGAAGG - Intergenic
1159833956 18:73313324-73313346 CATAGAAAAGACAAGGAAGATGG - Intergenic
1160688169 19:446952-446974 CATGGCAAAGCCTATGAGGTGGG - Intronic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1165343004 19:35225571-35225593 AGAGGCAAAGGCAAGGAGGATGG + Intronic
1166231822 19:41428950-41428972 CATGGCAAAGGCAAAAAGAAAGG - Intronic
1166823271 19:45593668-45593690 CATGTCACAGACAGGGAGAAGGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1166979408 19:46623887-46623909 CATGGCAAAGAGGATGAGCATGG + Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167752052 19:51387375-51387397 CATGGCCACCACCAGGAGGATGG + Exonic
1168663732 19:58186643-58186665 CAAGGCAGAAACAAGGAGAAGGG + Intronic
925618736 2:5769243-5769265 CATGGGGAAGTCAAGGAGGGAGG + Intergenic
926654271 2:15383329-15383351 CATAAAAAAGACAAGGAAGAGGG + Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927831378 2:26353676-26353698 GTTGGCAGAGACAAGAAGGATGG + Intronic
928251186 2:29682157-29682179 GATGGCAAAGAGATTGAGGAGGG + Intronic
929288711 2:40165052-40165074 CATAAGAAAGCCAAGGAGGAAGG + Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
931842162 2:66164815-66164837 GATGGCAAAGACTGGGAGAAGGG + Intergenic
932411073 2:71548203-71548225 CAGGGCAAAGACAGCAAGGAGGG - Intronic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
934685341 2:96317118-96317140 CATGGGAAAGCCAAGGAGATAGG + Intergenic
934767268 2:96886654-96886676 CCTGGCAAAGACAGGGAAGAAGG + Intronic
935798857 2:106672080-106672102 CATGACAACACCAAGGAGGATGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937825380 2:126363538-126363560 CATGGCAGAGGCAGGGAGGAAGG - Intergenic
938795238 2:134713319-134713341 CCTGACAAAAACAAGGAGAAAGG + Exonic
938954948 2:136288703-136288725 GATGGCAAGGACAGGGAGAATGG - Intergenic
939589875 2:144051808-144051830 AAGGGCAAAGAAAAGGCGGAGGG + Intronic
940135335 2:150429313-150429335 CATAGCAAAGTAAAGGAAGAAGG + Intergenic
940865961 2:158817978-158818000 AAAGGCCATGACAAGGAGGAGGG + Intronic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
942403030 2:175623297-175623319 GATGGCAGTGATAAGGAGGAAGG - Intergenic
943441630 2:187933593-187933615 CATGGCATAGACAAGGACTAGGG - Intergenic
943584266 2:189719379-189719401 CATACCAAAGACAAGATGGAAGG + Intronic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944371444 2:198988076-198988098 CTTGGCAGAAACCAGGAGGATGG - Intergenic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945212401 2:207397441-207397463 CATGGAAAAGGAAAGGAGGGTGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947584447 2:231344986-231345008 CACGGGGAAGACAAGGCGGAAGG + Exonic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
1168892659 20:1305134-1305156 AATGGCATGGCCAAGGAGGATGG + Exonic
1169271772 20:4205540-4205562 GTTGGCAAAGAAAAGGAAGATGG + Intergenic
1169803151 20:9532188-9532210 AATGGCAATGACAATGAGTATGG - Intergenic
1171408189 20:24928065-24928087 CAGGCCCCAGACAAGGAGGATGG + Intergenic
1172014119 20:31862879-31862901 CATGGCAAAGGCCTGGAGGTGGG - Intronic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172306219 20:33882583-33882605 TAGGGCAGAGACAAGGAGGTGGG - Intergenic
1172624386 20:36338891-36338913 CATGGCAAAGGCACCGAGGCAGG + Intronic
1173410437 20:42804780-42804802 GAAGGCAGAGATAAGGAGGAGGG - Intronic
1173757422 20:45529586-45529608 AATGGTAATTACAAGGAGGATGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1177029543 21:15965859-15965881 TATGGCAAAGACTAGAAGAAGGG + Intergenic
1177402699 21:20626077-20626099 CAAGGAAAAGACAAAGAGGAAGG + Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177969182 21:27767219-27767241 CATGGAACAGAAAAGGAAGAAGG - Intergenic
1178610606 21:34075328-34075350 TATGGCAAAAACAAAGGGGAGGG - Intronic
1179137822 21:38696169-38696191 CATGGCAGAGCTGAGGAGGAAGG + Intergenic
1179300639 21:40106248-40106270 CATGGGAAAGACCCGGTGGAAGG - Intronic
1179400397 21:41077451-41077473 CATTGCAAAGCCAAGGAGGGGGG - Intergenic
1179974468 21:44856297-44856319 GATGGCAATGCCCAGGAGGAGGG + Exonic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181718329 22:24752333-24752355 CATGGCAGGGACAAGGAGAAGGG - Intronic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1183008915 22:34928676-34928698 TATGGCAAAGCCAAAGAGGTAGG + Intergenic
1184193650 22:42911718-42911740 CATGGCAAACATAAAAAGGAAGG + Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185063600 22:48619952-48619974 CATGTCACAGCCAGGGAGGAGGG - Intronic
1185065010 22:48627790-48627812 CATGGCCAGGACGAGGGGGAGGG + Intronic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
949952841 3:9243295-9243317 AATGGGAAAGACCTGGAGGAGGG + Intronic
950168736 3:10821341-10821363 CATGGCAAATAGAATGATGATGG + Intronic
950340428 3:12239473-12239495 CTTGGGAAAGCCAAGGAGAAGGG - Intergenic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
951156272 3:19357338-19357360 TATGGCAAAGAAAATGTGGATGG + Intronic
952160439 3:30688215-30688237 AATGGCTAAGATAAGAAGGAAGG - Intronic
952257978 3:31711925-31711947 AATAGCAAAGGCCAGGAGGAAGG + Intronic
952712163 3:36442664-36442686 CATGGCCAAAACAAGAGGGAGGG + Intronic
953089034 3:39705271-39705293 CATGGGAAATCCAAGAAGGAGGG - Intergenic
954085423 3:48240360-48240382 CAGGGCAAAGAAAAGGACGGCGG + Intergenic
954856216 3:53646095-53646117 GACGGCAAAGACATGGAGGTGGG + Intronic
954886314 3:53877382-53877404 CAAGGCCTAGAAAAGGAGGAGGG + Exonic
954932881 3:54299250-54299272 CATAGCAGAGGCAGGGAGGAGGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955875387 3:63484543-63484565 CATGGCAAAGGCAATGGAGAAGG + Intronic
956050710 3:65245285-65245307 CAAAGCAAAGACAAGGAAGTTGG + Intergenic
957090911 3:75729227-75729249 CATAGCATAGACAAAGAGGGAGG + Intronic
958144712 3:89609268-89609290 CACGTCAAAGACAGAGAGGATGG + Intergenic
958648325 3:96902117-96902139 CATGGAAAGGACAAGGACGATGG + Intronic
958914341 3:100031707-100031729 GAAGGCAAAGACAGGGAGGGAGG + Intronic
959030935 3:101299007-101299029 CCTGAAAAAGACAAGGAGAAAGG - Intronic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961359996 3:126360930-126360952 CATGGCAGAGACGGGGATGAGGG - Intergenic
961919062 3:130407144-130407166 CAAGGCAAAGATGTGGAGGAAGG + Intronic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
963255421 3:143139976-143139998 AGCGGAAAAGACAAGGAGGAAGG - Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964529456 3:157651537-157651559 CATGGCAAAGCAGGGGAGGAAGG + Intronic
964655394 3:159061369-159061391 TATGGCAAAGACCACGAGGTTGG + Intronic
965727715 3:171736662-171736684 CCTCCAAAAGACAAGGAGGAAGG + Intronic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
969046189 4:4338565-4338587 GATGGCAAAAACAGAGAGGAGGG - Intergenic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970099144 4:12501336-12501358 GAAGGCAAAGAAAAGGAGAAGGG + Intergenic
970664448 4:18320611-18320633 CCTGGCAAAGGCAAGGCGCATGG + Intergenic
971172073 4:24243582-24243604 CATGGCAAATAGAAAGAGTAGGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
972161390 4:36232215-36232237 CATGGCAAAAGCAGTGAGGATGG - Intronic
973013281 4:45104360-45104382 AAAAGCAATGACAAGGAGGATGG + Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973723822 4:53752122-53752144 CATAGCTAATACATGGAGGAAGG - Intronic
974275518 4:59715935-59715957 GATGGCAAAGATAAGCAGAAAGG - Intergenic
975902865 4:79173717-79173739 CATGGCCAAGGCAAAGAGGTGGG + Intergenic
975940962 4:79645111-79645133 GACTGCAAAGAAAAGGAGGATGG + Intergenic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976204204 4:82609245-82609267 CTTGGCAAAGGCAACGGGGAAGG - Intergenic
976816821 4:89158121-89158143 GATAGCAAAGAAAAGGAGAAGGG + Intergenic
976870579 4:89788498-89788520 CATGGCAAGAACAAGGGGGAAGG + Intronic
977277523 4:94996223-94996245 CATGTCAAAGCTAATGAGGAGGG + Intronic
978837090 4:113163978-113164000 CATGGGGAGGACAAGGGGGAGGG - Intronic
979969517 4:127116486-127116508 AATGTCATAGACAAGGATGAAGG - Intergenic
980327879 4:131371787-131371809 CATTGCCAAGACAATGAAGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980636969 4:135518612-135518634 AATGGCAAAGACAAGGTGCTGGG + Intergenic
980698652 4:136394932-136394954 CAAGCCAAAGAAAAGGAGGGTGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
981459987 4:145001996-145002018 CATGGAAAATAAAAGAAGGAAGG + Intronic
981931231 4:150191210-150191232 CATGGCAAAGACAGGGTTGGGGG + Intronic
982629614 4:157815379-157815401 GATGGAAAAGTCAAGGAGCACGG + Intergenic
982653292 4:158114502-158114524 CATGGAAAAGCACAGGAGGAGGG + Intergenic
983587734 4:169374318-169374340 AATAACAAAGACAAGGAAGAAGG + Intergenic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984417146 4:179476595-179476617 ACTGGCAAAGACATGGAAGAAGG + Intergenic
984894205 4:184522211-184522233 CATGGTAAAGCTAAGGAGGTGGG - Intergenic
985026883 4:185747183-185747205 CGTCGGCAAGACAAGGAGGAAGG + Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
988390094 5:30616553-30616575 CATGACAAAACCAAGGGGGATGG + Intergenic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
992154913 5:73945491-73945513 CATGGAAAAGAAAAAAAGGAGGG + Intergenic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992962318 5:81968402-81968424 TATTGCAAAGACAAGGAACAAGG - Intergenic
993221112 5:85098330-85098352 AAAGGCAATGACAAAGAGGAGGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994190598 5:96865158-96865180 CATTTAGAAGACAAGGAGGATGG - Intronic
995337427 5:111016137-111016159 CATTCCAAAGGCAAGGAGGAAGG + Intergenic
995777018 5:115734582-115734604 CATGGCAAAGACTAGAGTGAGGG + Intergenic
996635099 5:125679597-125679619 CATGTTAAAGACAAGGAGTATGG + Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
998621392 5:143798016-143798038 CATTTCAAAGACAAGGAAAAAGG + Intergenic
999259896 5:150231760-150231782 CATGGCAAAGCAAAGGTGGTAGG - Intronic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1002040470 5:176510171-176510193 CATGGCATTGCCAAGAAGGAAGG + Intergenic
1002424630 5:179167862-179167884 CACGGCAGAGACAAGGACAAGGG - Intronic
1002863572 6:1101428-1101450 CATGGAAACGACAATGAGCAGGG + Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003057763 6:2838401-2838423 CATGGCAAAAACAATATGGAAGG - Intronic
1003151050 6:3549188-3549210 GATGGCAATGCCAGGGAGGACGG + Intergenic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1004034178 6:11906612-11906634 AATGGGAAGGACAAGGAGAATGG - Intergenic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004748668 6:18538573-18538595 CAAGGCAAAGAAAGGGAGGGAGG - Intergenic
1005089200 6:22038549-22038571 GAAGAAAAAGACAAGGAGGAGGG - Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1007116886 6:39349225-39349247 CAAGGCCAAGACAAGGTGGAAGG + Intronic
1007310352 6:40940514-40940536 CATGGAAAAGGCAAGCAGGGTGG + Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1008872353 6:56287569-56287591 CATGGTAAAGGCGAAGAGGAAGG - Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010061600 6:71628719-71628741 TCTGGCAAGGATAAGGAGGAGGG - Intergenic
1010079922 6:71848776-71848798 CCAGGCAGAGACAAGAAGGAAGG + Intergenic
1010192693 6:73209907-73209929 AATGGAGAAGACAAGGATGAAGG + Exonic
1012005174 6:93704924-93704946 CAGGGCAAAGGCAAGGCAGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012261363 6:97091308-97091330 CATGACACAGACACGGAGGCAGG - Intronic
1013618247 6:111864729-111864751 CAAAGCAAAGGCAAGGAGGCAGG + Intronic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014617003 6:123615156-123615178 AATGGCAAGGACATGGAGAAGGG + Intronic
1014857691 6:126422420-126422442 CATGGGCAAGCCAAGGAGAAAGG - Intergenic
1014866302 6:126534461-126534483 TATGGCAAACACAATGAGAATGG + Intergenic
1015547470 6:134376196-134376218 CATAGCATAGAGAAGGAGCATGG - Intergenic
1015602302 6:134922304-134922326 CAAGGCAAAAACAATAAGGATGG - Intronic
1016313789 6:142763285-142763307 AGTGGCACAGACAAGGAGAAGGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017741277 6:157408995-157409017 GATGGAAAAGAAAAGAAGGAGGG + Intronic
1017900481 6:158715147-158715169 CATGACAAATACAAGGGGGTGGG - Intronic
1018949576 6:168370533-168370555 CCGGGCACAGACAAGGAGAAGGG - Intergenic
1019566566 7:1683795-1683817 ATTGTCAAAGACAAAGAGGAAGG - Intergenic
1019579302 7:1752188-1752210 CTTGGCAGAGACAAGGCGGCAGG + Intergenic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1020596440 7:10213141-10213163 CATGGCATAGACAAGGTCTAGGG - Intergenic
1020740933 7:12017383-12017405 CATGGCAGAGGAAAGGAGGATGG + Intergenic
1020822912 7:12992490-12992512 CATAGCAAAGACACGAAAGACGG - Intergenic
1021827661 7:24571718-24571740 CAAGGCAGAGACAAAGCGGAAGG - Intergenic
1022467858 7:30663499-30663521 GATGGCAAAGACAGGCATGAGGG + Intronic
1022665501 7:32406690-32406712 CTTGGCTGAGACAAGGAGGCAGG + Intergenic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1024051442 7:45626318-45626340 CATGGCAAACACAGGGCGTATGG - Intronic
1024861892 7:53853775-53853797 CATGGCCATGACCATGAGGAAGG - Intergenic
1028162691 7:87504322-87504344 AATGGCAGAGTCAAGGAGCATGG - Exonic
1028410762 7:90528329-90528351 CATGGAAAAGACAAGGGCAAAGG - Intronic
1028637115 7:93001675-93001697 CAAGGCAATGACAATAAGGATGG - Intergenic
1028920949 7:96309554-96309576 CATGGCAAAGTAAAGGGGGAAGG - Intronic
1029254836 7:99262672-99262694 CATGGCAAGGGTAAGGAGGAAGG - Intergenic
1029408643 7:100393792-100393814 CCTGGCAAAAAATAGGAGGAAGG + Intronic
1029487981 7:100854695-100854717 GATGGCACAGACAGAGAGGACGG - Exonic
1029731165 7:102439159-102439181 CATGGCAAAGCCGGAGAGGAGGG - Exonic
1030063277 7:105640040-105640062 CATGGCTAAAACTAGCAGGAAGG - Intronic
1030111636 7:106031689-106031711 TATGGAAAAGACAAGGAGCAAGG + Intronic
1031790270 7:126093626-126093648 CATGGCAAGGACATGGTGGAAGG - Intergenic
1031972599 7:128075184-128075206 CATTGAAGAGACAAGGGGGATGG + Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032653497 7:133903793-133903815 CATGGCAAAGAAGAGGACCATGG + Intronic
1032763791 7:134971197-134971219 ACTGGCAATGAGAAGGAGGATGG - Intergenic
1033606858 7:142933829-142933851 CCTGGGGAAGAAAAGGAGGAGGG + Intergenic
1033651744 7:143349137-143349159 CATAGAAAAGACCAAGAGGACGG + Intronic
1033651835 7:143349967-143349989 AATAGCAAAGACAAAGGGGAAGG + Intronic
1033808317 7:144979396-144979418 TAAGGCATAGACAAAGAGGAAGG + Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034451835 7:151141365-151141387 CATGGCATAGACAGGCAGGAAGG - Intronic
1034879549 7:154752859-154752881 CAAGGGAAAGACATGGTGGACGG + Intronic
1034893049 7:154857472-154857494 CATGGCAAACACCTGGAGGCTGG - Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035088617 7:156284959-156284981 CATGACCAAGACAATGAAGATGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036734008 8:11292042-11292064 CTTGGAAAAGAAAAGAAGGAAGG - Intronic
1037197552 8:16209529-16209551 TTTGGAAAAGACAAGGAGAATGG - Intronic
1037286722 8:17309488-17309510 CATGGCAAAGGCAAAGTTGAAGG + Intronic
1038260956 8:25993501-25993523 CATGGCTCAGACCAGGAGGGTGG - Intronic
1038287547 8:26218971-26218993 CATGGGAAAGGCATGGAGGTTGG + Intergenic
1040276799 8:46018016-46018038 AATGGCATAGTCAAGGAGGGGGG - Intergenic
1040951488 8:52941669-52941691 AAAGGCAAAGAAAAGGAGTAGGG - Intergenic
1041485159 8:58368434-58368456 CATGGCAAACACCACGAGCAAGG - Intergenic
1041629705 8:60072927-60072949 CATGGCAAAGAATTGAAGGAAGG + Intergenic
1042426982 8:68660508-68660530 CATGGCATAGACAAGGTCTAAGG - Intronic
1042462856 8:69091103-69091125 TATGGCCAAAACAAGGAGGGTGG + Intergenic
1043617825 8:82149052-82149074 CATGTCAAAGACCAGGTGGAGGG + Intergenic
1044537541 8:93374604-93374626 GATGGCAAAGCCAAGGAAGTGGG + Intergenic
1045108174 8:98913902-98913924 CATCGCAAAAACACGGAGGCTGG + Intronic
1045987405 8:108264574-108264596 CATGGCTGAGAGCAGGAGGAAGG - Intronic
1047926285 8:129686091-129686113 CATGGCATAAACAAGGATGATGG + Intergenic
1047938313 8:129803140-129803162 AGTGGCAAAGAGAAGGAGAAAGG - Intergenic
1048083053 8:131149275-131149297 GATGGCAATGATATGGAGGAGGG - Intergenic
1049697717 8:143991700-143991722 CATGGAAACTACCAGGAGGAGGG + Exonic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051251435 9:15162651-15162673 CAAAGGAAAGACAAGCAGGAAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052370869 9:27663179-27663201 AATGGCAAGGGAAAGGAGGATGG - Intergenic
1053008752 9:34621584-34621606 GAGGGCAAAAACAAGCAGGAGGG + Intronic
1054784925 9:69201363-69201385 CCTGACAAAGAAAAGGGGGAGGG - Intronic
1055194877 9:73577847-73577869 CCTGTCAAAGACAATGAGTAGGG - Intergenic
1055229532 9:74044953-74044975 CATCCCAAAGACATGGAGGTAGG + Intergenic
1055813902 9:80183021-80183043 AATGGCAGAGACAATGTGGAAGG + Intergenic
1055958215 9:81794174-81794196 TATGGCTAAGACTAGGAAGAAGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056775825 9:89511974-89511996 CATGGCAGAGAGATGGAAGAGGG - Intergenic
1056794459 9:89648062-89648084 CACAGCACAGACAAGGGGGAGGG - Intergenic
1057164694 9:92916436-92916458 CAGGGCTCAGACAAGCAGGAGGG + Intergenic
1057887824 9:98844571-98844593 AATTGCAAAGACAGGGAGGCAGG - Intronic
1057908145 9:98998413-98998435 CATGACAGAGCCAAGGAGGCAGG + Intronic
1058199912 9:102026845-102026867 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1058596410 9:106620719-106620741 CAATGGAAAGACAAGAAGGAGGG + Intergenic
1058627820 9:106953569-106953591 CATGGCAAAAACAAGGTAAAGGG - Intronic
1058846329 9:108963304-108963326 CATCTCAAACACAAAGAGGAAGG + Intronic
1059421376 9:114194553-114194575 CATGGCAAAGGCAGGGAGGTGGG + Intronic
1059632040 9:116135274-116135296 CATGCCAAATACAAGGGAGAAGG - Intergenic
1059723384 9:116983373-116983395 CATGACTAGTACAAGGAGGAAGG + Intronic
1061898924 9:133663035-133663057 CAAGGGCCAGACAAGGAGGAGGG + Intergenic
1062261430 9:135665040-135665062 CAAGCCAATGACAAGGAGGGAGG + Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1186296609 X:8155578-8155600 ACTGGCAAAGAAAAGGAGGTGGG + Intergenic
1186470588 X:9818994-9819016 AAGGGCAAAGACAAGGAAAATGG - Intronic
1186749723 X:12609168-12609190 CAATGTAAAGACAATGAGGATGG - Intronic
1187083918 X:16021933-16021955 CATGGGGAAACCAAGGAGGAGGG + Intergenic
1187204425 X:17168747-17168769 ACAGGCAAAGACAAGGAGAAAGG + Intergenic
1187278715 X:17839465-17839487 CATGGCAAAGACTAACAGCAAGG - Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189762289 X:44333869-44333891 CATGTTCAAGACAAGCAGGAAGG - Intronic
1189845378 X:45131697-45131719 CATGGAAAAGACAGAGAGAAAGG - Intergenic
1192429698 X:71103617-71103639 AAAGGCAGAGACATGGAGGAGGG + Intergenic
1193467198 X:81864881-81864903 CATGGAAAAGACCTGGTGGAAGG - Intergenic
1194645858 X:96457309-96457331 CATTGGTAAGCCAAGGAGGAAGG + Intergenic
1195248176 X:103015651-103015673 CATGACAACAACAAGGAGGATGG - Intergenic
1195272285 X:103243385-103243407 CATGACAAAAACAAGGAAGTTGG - Intergenic
1198122487 X:133607809-133607831 GAGGGCAAAGTCAAAGAGGAAGG + Intronic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198409417 X:136350613-136350635 TAAGGCAAAGACAAGAAAGATGG - Intronic