ID: 1114657555

View in Genome Browser
Species Human (GRCh38)
Location 14:24325196-24325218
Sequence GGATCTACAAGGTTAAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114657555 Original CRISPR GGATCTACAAGGTTAAGATA AGG Intronic
901853670 1:12031090-12031112 GGATCTGCCAGGATAAGAAAGGG + Intronic
902714272 1:18261734-18261756 GCATCTTCAAGGTTAAGGCAGGG - Intronic
908107103 1:60856267-60856289 GGATCTACCAGGTTCAAATAGGG + Intergenic
911204948 1:95082820-95082842 GGGTGTACAAGGTTAGGACAAGG - Intergenic
912261874 1:108118870-108118892 GCATCTAAAAGCTTTAGATAAGG + Intergenic
918343227 1:183584163-183584185 GGATCCTCAAGGTTCACATACGG + Intronic
1073107489 10:101040545-101040567 GAATGTACAATGTTAAGACAGGG + Exonic
1080048981 11:27839022-27839044 GGAGTTACAAGGTTAAGACAAGG + Intergenic
1085122815 11:73978093-73978115 GGATCTGCAAGGCCAAGACAGGG + Exonic
1086989244 11:93285164-93285186 GGATTTAAAATGTTAATATAAGG - Intergenic
1090501193 11:127263092-127263114 GAATCTAGAAGGTTCAGAGAAGG + Intergenic
1090811086 11:130244122-130244144 GGAACTGCAAGGTTAAATTAGGG - Intronic
1097045666 12:56186237-56186259 TGATCTACAAAATCAAGATACGG + Exonic
1098508201 12:71280160-71280182 GGATTTAGAAGGATAATATAGGG - Intronic
1098581919 12:72110115-72110137 GAATCTGCAAGTTTAAGATGAGG + Intronic
1101131163 12:101692655-101692677 TGAGCTACTATGTTAAGATAAGG + Intergenic
1106904702 13:34392974-34392996 GGAGGTATAAGGATAAGATATGG - Intergenic
1107410777 13:40156770-40156792 GGTCCCACAAGGTTAAGAAAAGG + Intergenic
1109303520 13:60614292-60614314 GCTCCTACAAGATTAAGATATGG - Intergenic
1110604602 13:77417543-77417565 GGATCTTCAGGGTTAAAATTTGG - Intergenic
1111507382 13:89210976-89210998 GGATGTACACAGTGAAGATAAGG + Intergenic
1111902134 13:94212631-94212653 CAATGGACAAGGTTAAGATATGG - Intronic
1114657555 14:24325196-24325218 GGATCTACAAGGTTAAGATAAGG + Intronic
1116778508 14:49209899-49209921 GGATCTAAAAGGTGAAAATAGGG + Intergenic
1140685757 16:77433045-77433067 AGATTTTCAAGGTTAAGAGAGGG - Intronic
1148843246 17:50512691-50512713 TGGTATAAAAGGTTAAGATATGG - Intronic
1151081760 17:71337245-71337267 GGATCTAAAAGGTGGAGAAAGGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153502403 18:5762598-5762620 CGATCTACAAGGATGAGATCAGG + Intergenic
1158854846 18:61532776-61532798 GTCTCTACAACGTTAAGATATGG + Intronic
1164475544 19:28573171-28573193 GGCTGTATAAGGTGAAGATATGG - Intergenic
1167785169 19:51630107-51630129 GGATCTCCAGGGGTAAGAGAAGG + Intronic
1167787268 19:51646531-51646553 GGATCTCCAGGGGTAAGAGAAGG + Exonic
930508179 2:52311002-52311024 GCATCTCCCAGGTTAAGATCTGG + Intergenic
933184603 2:79265022-79265044 GGATCTATAATAATAAGATAAGG + Intronic
934574364 2:95390945-95390967 GGATCTAGAAGGGGAACATACGG + Intergenic
934865149 2:97802289-97802311 GGATCTATAAGGTTGAGAGAAGG - Intronic
938943376 2:136188762-136188784 GGCACTGCAAGGTTAAGCTATGG + Intergenic
941482767 2:166038302-166038324 TGATCTACATGGTTAAAATATGG - Intronic
941597730 2:167498781-167498803 GGATCTGCAAGGAGAAGAAAGGG - Intergenic
942862185 2:180628060-180628082 GGATGTACAAGCTTAAGAGAGGG + Intergenic
943144486 2:184024701-184024723 GGGTCTACAAGTCTTAGATAAGG + Intergenic
946352047 2:219161577-219161599 GGAACTACAGGGATAAGACAGGG - Intronic
1170235291 20:14096759-14096781 GGACATGCAATGTTAAGATAAGG - Intronic
1175288231 20:57852370-57852392 GTATCAATAAGGTTAAGCTATGG - Intergenic
1180204055 21:46246306-46246328 TGATCTACAAGGTTCAACTAAGG - Exonic
1182652794 22:31865783-31865805 TGTTCTCCAAGGTTAAGATTAGG - Intronic
953509786 3:43524371-43524393 GGATCTACATGGGAAAGGTAGGG - Intronic
958643023 3:96833141-96833163 AGATGTACATGGTTAAGATGAGG + Intronic
962359834 3:134729558-134729580 GGCTCTAAAAGGGTAAGATCTGG + Intronic
966109358 3:176379902-176379924 GGATCTTCAGAGTTGAGATATGG - Intergenic
969998588 4:11340837-11340859 AGATCTACAAGGTTTTGAAATGG - Intergenic
970255472 4:14164954-14164976 GGATATACTAGGTTAAAAAAAGG + Intergenic
970705034 4:18790827-18790849 GGATCCACAACTTAAAGATATGG - Intergenic
970836914 4:20420534-20420556 GGTTCTACAAGGATAAAATTAGG - Intronic
975461020 4:74652965-74652987 AGATCTACAATGCTGAGATATGG - Intergenic
977388248 4:96372540-96372562 GAAACTACAAGGTTTAGATCAGG - Intergenic
977545897 4:98376306-98376328 GGATACACAAGTTTAGGATAGGG + Intronic
978525444 4:109660313-109660335 GGACCTACAAAATGAAGATAAGG + Exonic
979403361 4:120278898-120278920 GTATCTAAAAAGTTGAGATAAGG - Intergenic
986355442 5:6920300-6920322 TGATCTACCAAGTTAAAATAAGG - Intergenic
988078459 5:26383298-26383320 GGAACTCCAAGATTAAGATGTGG - Intergenic
993253531 5:85557724-85557746 GGTTCTCCAAGGTCAAAATAAGG + Intergenic
997922043 5:137990649-137990671 AGATATACAAGTTTAAAATAAGG + Intronic
1006219231 6:32474010-32474032 AAATCTACAACATTAAGATATGG - Intergenic
1006225097 6:32530715-32530737 AAATCTACAACATTAAGATACGG - Intergenic
1006231410 6:32590230-32590252 AAATCTACAACATTAAGATATGG - Intergenic
1006954961 6:37860856-37860878 GGATGTAGAAGGATGAGATATGG + Intronic
1009791673 6:68409615-68409637 GTATTTAAAATGTTAAGATATGG + Intergenic
1010742602 6:79526319-79526341 GGATCAACAAGGTCAGGAGATGG + Intronic
1018145657 6:160885101-160885123 GGATCTAAAAGTCTAAGATAGGG + Intergenic
1023091088 7:36618110-36618132 GTATCTAAAAGGTTCAGAAAAGG - Intronic
1024007178 7:45233494-45233516 GGATTTACCAGGTTAACATTTGG + Intergenic
1024379493 7:48679549-48679571 GAATCTACAAAGCTAAAATAAGG - Intergenic
1024711775 7:52023198-52023220 AGATCCACAAGGTCAAGAGATGG + Intergenic
1024835648 7:53514857-53514879 TGATATACAAGGTCAAGAAAGGG - Intergenic
1026428839 7:70323962-70323984 TGTTCTACAAGGTGAAGAAATGG + Intronic
1028109242 7:86919230-86919252 GGATATGCAAGTTTAAGATCAGG + Exonic
1030931475 7:115528120-115528142 GAATCTCCAAGTTTAAAATAAGG + Intergenic
1037860394 8:22400973-22400995 GGATCTAACAGCATAAGATATGG - Intronic
1044260456 8:90113825-90113847 ACATCTACAATGTTAAAATAAGG - Intergenic
1045153754 8:99441667-99441689 GGACCTCAGAGGTTAAGATAAGG - Intronic
1046544360 8:115629922-115629944 GGATTTTCAAGGGTGAGATAGGG - Intronic
1055363680 9:75522229-75522251 GGATATACTATGTTAAAATAAGG - Intergenic
1194070567 X:89320571-89320593 GTATCTCCAAGGTTTTGATATGG + Intergenic
1196180268 X:112681871-112681893 GATTCTGCAAGGGTAAGATATGG + Intergenic
1197745788 X:129931783-129931805 GGACCTACAAGGATTAGAGAAGG - Intergenic
1200724809 Y:6656310-6656332 GTATCTCCAAGGTTTTGATATGG + Intergenic