ID: 1114659974

View in Genome Browser
Species Human (GRCh38)
Location 14:24337875-24337897
Sequence TGGAAGGAGGGTCTGTCCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114659965_1114659974 0 Left 1114659965 14:24337852-24337874 CCAGCTAACTGGCCAGCTCACCC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 291
1114659962_1114659974 17 Left 1114659962 14:24337835-24337857 CCAAGCTTATCCTAGATCCAGCT 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 291
1114659964_1114659974 7 Left 1114659964 14:24337845-24337867 CCTAGATCCAGCTAACTGGCCAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 291
1114659961_1114659974 18 Left 1114659961 14:24337834-24337856 CCCAAGCTTATCCTAGATCCAGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 291
1114659960_1114659974 30 Left 1114659960 14:24337822-24337844 CCTGCTGACAGACCCAAGCTTAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114659974 Original CRISPR TGGAAGGAGGGTCTGTCCTT GGG Exonic
900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG + Intronic
900826030 1:4927764-4927786 TGGAAGCATGGTCTGACCCTTGG - Intergenic
901149624 1:7092561-7092583 TGGGAGGAGAGTCTGTCCGCAGG + Intronic
904247411 1:29197625-29197647 TGGAAGGAGCTGCTGTCCTAGGG + Intronic
905209838 1:36366520-36366542 GGAAAGGGGGGTCTGTCCCTGGG - Intronic
905646070 1:39625915-39625937 TGGAGAAAGGGTCTGTCCTGTGG + Exonic
906526036 1:46493812-46493834 TCGGAGGAGGGTCTGTCCTGCGG - Intergenic
907514006 1:54981716-54981738 AGGAGGGAGGCTCTGTCCTCCGG + Intronic
907624011 1:56010750-56010772 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
908690534 1:66774675-66774697 TGGGAGCAGTTTCTGTCCTTTGG - Intronic
908908898 1:69049286-69049308 TGGCAGAAGTGTCTGTCCCTGGG + Intergenic
910194965 1:84630756-84630778 TGGAAGCAGGGTCTTTCCCACGG + Exonic
910216728 1:84850989-84851011 TGGGAGGAGGGTATGCCCTGGGG + Intronic
912129543 1:106584868-106584890 TAGTAGGAGGATCTGGCCTTGGG - Intergenic
912258645 1:108086416-108086438 AGGAAGCAGGTTCTGTCTTTTGG - Intergenic
912639405 1:111330827-111330849 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
912933738 1:113985309-113985331 GGAAAGTAGGGTCTGTCCTGTGG + Intergenic
913659062 1:120990741-120990763 TTGAAGCAGGGGCTGTCCCTGGG + Intergenic
915783180 1:158577272-158577294 TAGAAGGAGGGTCTGTGAGTGGG - Intergenic
915963804 1:160289192-160289214 TGGAAGGAAGATATGTACTTTGG + Intergenic
916258555 1:162816724-162816746 AGGAAGGATGGTCTGTACGTGGG + Intergenic
918146166 1:181757998-181758020 TGGAAGGTGTGTCTGTTCTGCGG - Exonic
918331938 1:183470173-183470195 TAGTAGGAGTGTCTATCCTTGGG + Intergenic
918636014 1:186775027-186775049 AGGATTGATGGTCTGTCCTTAGG + Intergenic
919123708 1:193371613-193371635 TGGAAGAGGGGGCTGTGCTTTGG + Intergenic
920044317 1:203123765-203123787 GGGAAGGAGGGTCAGGTCTTGGG - Intronic
920248117 1:204603559-204603581 TGAAAGGAGAGTCTGGACTTGGG - Intergenic
920304191 1:205008357-205008379 TGGAAGGAGGCTCAGTGCCTTGG + Intronic
921432967 1:215083701-215083723 GAGAAGGAGGGTCAGCCCTTGGG + Intronic
921456668 1:215380099-215380121 TGGAAGGAAGGGGTGTCTTTTGG - Intergenic
1066338933 10:34510127-34510149 TGGAAGGAGAGTCAGAACTTAGG - Intronic
1067696713 10:48541187-48541209 TTGGAGGAGGCTCTGTACTTGGG + Intronic
1069971638 10:72175851-72175873 AGGAACCAGGGTCTGTCTTTGGG - Intronic
1069987781 10:72296050-72296072 TAGAAAGAGGCTCTGTCCTTGGG - Intergenic
1070359024 10:75669231-75669253 TGGCATCAGGGTCTGTGCTTGGG + Intronic
1071707218 10:88012218-88012240 TGGAAGGAAGCACTGTGCTTAGG - Intergenic
1072724373 10:97802749-97802771 TGGGAGGAGGGTCTGACCAGTGG + Intergenic
1073628323 10:105121930-105121952 TGGGAGGAGGGGCTGCCTTTGGG + Intronic
1074217281 10:111398056-111398078 GGGCAGGAGGGTCTGACCTTTGG - Intergenic
1074225343 10:111479222-111479244 TGGCAGGAGGAGCTCTCCTTGGG - Intergenic
1076110456 10:127855718-127855740 TGGAAGGAGGGTGTCTACTGGGG + Intergenic
1077047889 11:554374-554396 TGGAAGGAGTGCCTGGCCCTGGG + Exonic
1077172883 11:1176270-1176292 CAGATGGAGGGTCTGTCATTGGG - Intronic
1079229582 11:18637961-18637983 TGGAAGGGCTGTGTGTCCTTAGG + Intergenic
1079668314 11:23135108-23135130 AGGATGGAGGGTCTGTACTGTGG + Intergenic
1080263232 11:30373608-30373630 TCGAAGGAGTATGTGTCCTTTGG - Intergenic
1081909899 11:46694175-46694197 TTGCGGGAGGGTCTGGCCTTGGG - Intronic
1083282935 11:61638557-61638579 TGGCTGGAGGGTCTCTCCTAAGG - Intergenic
1083401995 11:62429939-62429961 TGGAAGGAGGAGCAGGCCTTGGG + Intergenic
1083691290 11:64410418-64410440 TGGAAGAAAGGTCTGGCCATGGG + Intergenic
1084670050 11:70600715-70600737 TGGAAGGATGGGGTGTCCTCAGG + Intronic
1084785134 11:71437727-71437749 TTGCAGAAGCGTCTGTCCTTGGG - Intronic
1084857944 11:72000818-72000840 TGGGTGGAGGGGCTGGCCTTGGG - Intronic
1085785148 11:79441644-79441666 AGGAAGGAGGGCCTTTCTTTGGG - Intergenic
1085856401 11:80181188-80181210 TGGAAGTAGTGTTTGTTCTTGGG + Intergenic
1086189277 11:84059385-84059407 AGGAAGCAGGGTCTATCGTTCGG - Exonic
1086219679 11:84427657-84427679 TTGAAGGAGGGACAGTGCTTGGG - Intronic
1089388585 11:118084610-118084632 TTCAAGGAGGGTCTGTGCTGTGG - Intronic
1091239122 11:134040684-134040706 TGGGAGGATGGTGTGTGCTTTGG - Intergenic
1092497507 12:9011790-9011812 TGGAGAGAGAGTCTGTGCTTTGG + Intergenic
1094679965 12:32659177-32659199 TGGAAGGAGGGGAAGTGCTTAGG - Intergenic
1095835940 12:46638543-46638565 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1103191363 12:119004856-119004878 TGGAAGAAGGGTCTGTGGTTTGG - Intronic
1103590083 12:121985926-121985948 TGGAAGGACCGCTTGTCCTTGGG + Intronic
1104477736 12:129084380-129084402 TGGAGGGAGGCTTGGTCCTTAGG + Intronic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1104731261 12:131106721-131106743 ATGAAGGTGGGTCTGTCCATAGG - Intronic
1105503608 13:20992081-20992103 TGGAAGGAGGCTTTCTCCTGTGG - Intronic
1106159297 13:27186086-27186108 TGGCAGTAGGGTCTGTTCTTTGG + Intergenic
1106373334 13:29158850-29158872 TGGAACCAGGGTCTGGTCTTCGG + Intronic
1107496790 13:40934264-40934286 TGGAAGAAAGGTCTGTACATAGG + Intronic
1109031814 13:57199923-57199945 TGGAATGAGAATCTGTGCTTGGG - Intergenic
1109728156 13:66372656-66372678 TGGAAGAAGGGAATGTCCATTGG + Intronic
1110729503 13:78863999-78864021 TGGAAGGATTGGCTGTCCTCTGG + Intergenic
1111944284 13:94647511-94647533 GGGATGGAGGCTCTGTCCTCAGG + Intergenic
1113226967 13:108169452-108169474 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1113750980 13:112776277-112776299 TGGAAGGAGGGTCTGGGATCTGG - Intronic
1114059040 14:19002182-19002204 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1114103503 14:19399572-19399594 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG + Exonic
1114897715 14:27012275-27012297 TGGAAAGAATGACTGTCCTTGGG - Intergenic
1116316144 14:43395037-43395059 TGGAAGCAGAGTCTGTCATGTGG - Intergenic
1117159429 14:52974092-52974114 TGGAAGGAAGGTGTCTCTTTTGG + Intergenic
1117737298 14:58780765-58780787 AGGTGGGAGGGACTGTCCTTTGG + Intergenic
1120710757 14:87790653-87790675 TGGGTGGAGGGTGTGTCCTAAGG + Intergenic
1121660624 14:95632564-95632586 TGGAAGGACGGCATGGCCTTGGG + Intergenic
1121702406 14:95964600-95964622 TGGAAGGAGGGGCTGAACTTGGG - Intergenic
1122524496 14:102371170-102371192 TGGAAAGAGGGTCAGTTCTGTGG + Intronic
1122946835 14:105015180-105015202 GGGCGGGAGGGTCTGTCGTTGGG - Intronic
1123496777 15:20834449-20834471 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1123554010 15:21408041-21408063 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1123590256 15:21845406-21845428 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1124880779 15:33640548-33640570 TTGAAAGTGGATCTGTCCTTTGG + Intronic
1126198748 15:45961356-45961378 TTGAGGGAGGGTCTCTCATTAGG - Intergenic
1128930143 15:71697040-71697062 AGGAAGGAGGGAGTGCCCTTTGG + Intronic
1129584577 15:76849456-76849478 AGGATGGAGGGTCTGTGCTGTGG - Intronic
1129623918 15:77176763-77176785 TGGAAAGAGACTCTCTCCTTTGG - Intronic
1130325044 15:82872993-82873015 TGGCAGGAGGGGCTGTTCTATGG + Intronic
1132026702 15:98409921-98409943 TGAAAGGTGCCTCTGTCCTTAGG - Intergenic
1202962358 15_KI270727v1_random:135237-135259 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1132644227 16:991466-991488 GGGCAGGTGGTTCTGTCCTTTGG + Intergenic
1132770136 16:1557407-1557429 TAAAAGGAGGGTGTGGCCTTAGG - Intronic
1133675095 16:8063679-8063701 TGGAATGAGGGACAGTCATTGGG - Intergenic
1135173710 16:20209636-20209658 TGGCAGGAGGGGCTGTCCTTTGG - Intergenic
1138399771 16:56735945-56735967 AGGAATGAAGGTCTGGCCTTAGG + Intronic
1138595513 16:58027146-58027168 GGGAGGCAGGGTCCGTCCTTAGG - Intronic
1140326063 16:74004970-74004992 TGGCAGGTGGGTGTGTCCTTGGG + Intergenic
1141027808 16:80564320-80564342 CTGGAGGAGGCTCTGTCCTTGGG + Intergenic
1142806107 17:2372104-2372126 AGGGAGGAGGCTCTGTCCTGGGG - Intronic
1144298904 17:13904991-13905013 TGGGAGGGGAGTCTGTCCCTAGG + Intergenic
1145037753 17:19553072-19553094 TGGAAGGAGTTTCTGTCCTGGGG + Intronic
1146691889 17:34882496-34882518 AGGAAGCAAGGACTGTCCTTAGG - Intergenic
1146807380 17:35875735-35875757 GGCAAGGAGGGGCTGTTCTTTGG - Intronic
1146845403 17:36178982-36179004 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146873618 17:36390825-36390847 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146880977 17:36441913-36441935 TGGGTGGAGGGCCTGGCCTTTGG + Intergenic
1147065770 17:37922048-37922070 TGGGTGGAGGGCCTGGCCTTTGG - Intergenic
1147599883 17:41738970-41738992 TGTAAGGAGGGACTGTACCTGGG - Intergenic
1147915633 17:43883579-43883601 GGAAAGGAAGGTTTGTCCTTTGG - Intronic
1151408937 17:73907885-73907907 TGGTAGGAGGGTGTGTCCCCTGG - Intergenic
1151583053 17:74990953-74990975 TGGAATCAGGGCCTGCCCTTTGG - Intronic
1151598616 17:75093151-75093173 GGGCAGGAGGGTGTATCCTTGGG + Intronic
1152006470 17:77685037-77685059 TGGAGGCAGGGACTGTCCTGTGG - Intergenic
1153289161 18:3483348-3483370 TGGAAGGAGGGACTGGGTTTAGG + Intergenic
1157606583 18:48929817-48929839 TGGGAGAAGGGTCTGCCTTTGGG - Intronic
1158601807 18:58862975-58862997 TGGAAGAAGGGGCTCTCCTCTGG - Exonic
1161574948 19:5049928-5049950 TGGAAAGAGTGTCTGGCCTCTGG + Intronic
1162959289 19:14116959-14116981 TGGAAGGGGGGGCTGTGCTAAGG + Intronic
1163323950 19:16591231-16591253 GGGAAGGAGGGTGGGCCCTTTGG + Intronic
1164147126 19:22518927-22518949 TGGAAGAAGGGCATGTCCCTGGG - Intronic
1166828015 19:45621399-45621421 GGGGAGGAGGGTCTGGCGTTGGG + Intronic
1167142952 19:47664877-47664899 TGGAAGGAGAATCTTTCCGTAGG + Intronic
1168627369 19:57929997-57930019 TCTAAGGAGGGTCTTGCCTTTGG + Intronic
1168671816 19:58246445-58246467 TGGAAGGAGGTTCTACCCCTAGG + Intronic
926809298 2:16742167-16742189 TGGAAGCAGGGCCTGGCCTGTGG - Intergenic
926961005 2:18358395-18358417 TGGAAGCAAGGTCTGTCACTTGG - Intronic
927124914 2:20005277-20005299 AGGGAGAAGCGTCTGTCCTTGGG - Intronic
928462123 2:31484972-31484994 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
929890250 2:45912762-45912784 TGAGAGAAGGGTCTGTCATTTGG + Intronic
930108580 2:47658811-47658833 TGGTTGGAGGATCTGTCTTTTGG + Intergenic
931446696 2:62332782-62332804 TGGAAGGAGGCTCAGTTCTGTGG - Intergenic
932781368 2:74560612-74560634 TGGAGGGAGGGTGTGTCAGTGGG + Intronic
932826073 2:74941457-74941479 TGAGGGGAGGGTCTGTTCTTAGG - Intergenic
934319759 2:91961430-91961452 TGGAAGGAGGGGCTGGAGTTGGG + Intergenic
937359415 2:121218625-121218647 GGGAAGGACGGTCAGTGCTTGGG - Exonic
937884028 2:126888033-126888055 TGGATGGAGGGTCAGGCCCTGGG - Intergenic
938282144 2:130072050-130072072 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
938332771 2:130460622-130460644 AGGATGGAGGGTCTGTGCTGTGG + Exonic
938357037 2:130660049-130660071 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
938477512 2:131629441-131629463 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
939710348 2:145509488-145509510 TGGAAGGAAGGGGTGTCTTTTGG + Intergenic
941128386 2:161615281-161615303 TGGAAGAAGCCTTTGTCCTTTGG - Intronic
941714960 2:168754202-168754224 AGGAAGGAGGGTCTGTTTCTTGG + Intronic
942498690 2:176565603-176565625 AGGAAGGAGGCTGTGACCTTGGG - Intergenic
944131415 2:196351513-196351535 TGGTAGGAGGGTAAGTGCTTTGG - Intronic
945823882 2:214697125-214697147 TGCCAGGAGGGCCAGTCCTTGGG - Intergenic
948571467 2:238920433-238920455 GGGAAGGTGGGTCTGTCTGTTGG - Intergenic
948681471 2:239637995-239638017 AAGATGGAGGGTCTTTCCTTAGG - Intergenic
948816724 2:240514059-240514081 TGTAAGGAGGGTGTGGCCTCCGG - Intronic
1169854573 20:10089203-10089225 GGAAAGGATGGCCTGTCCTTGGG + Intergenic
1169868832 20:10230088-10230110 TGGAAGCAGGTTCTGTCACTTGG - Intronic
1169945711 20:10985800-10985822 GGAAAGGAGGGTGTTTCCTTTGG + Intergenic
1172244128 20:33434043-33434065 TGGAAGGATGGCCTGTCCTTTGG - Intronic
1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG + Intronic
1172315990 20:33954821-33954843 TGGAACAGGGGTCTGTCCATGGG + Intergenic
1174333419 20:49839594-49839616 TGGAAGGTAGGTTTGCCCTTTGG + Exonic
1176977029 21:15334362-15334384 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1177223324 21:18221912-18221934 TGAATGGTGGGTCTATCCTTGGG + Intronic
1179345310 21:40550584-40550606 GGAAAGAAGGGTCTGTCCTAAGG - Intronic
1179518788 21:41928439-41928461 TTGAATGAGGGTCTTTCCTAGGG - Intronic
1180477524 22:15724798-15724820 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1181030882 22:20148463-20148485 TGGAGGTGGGGTCTGTCCTGAGG - Exonic
1181436877 22:22916337-22916359 TGTAAGGAGGGTGTGTCCCCGGG - Intergenic
1183041756 22:35185094-35185116 TGGATGGAGGGTCTGTGCTGTGG - Intergenic
1183663225 22:39233627-39233649 TGGAAGGAGGGACTGTTCTCTGG - Intronic
1185369685 22:50455318-50455340 GAGAAGGAGTGGCTGTCCTTCGG - Exonic
950170650 3:10837072-10837094 TGGCAGGAGGGGCTGGCCCTGGG + Intronic
950529862 3:13547031-13547053 TGGAAGGCGGGCCAGGCCTTGGG + Intergenic
954498700 3:50989155-50989177 AGGATGGAGGGTCTGTGCTGTGG - Intronic
955588265 3:60505818-60505840 TGGAAAGAGGTTTTGTCCGTTGG - Intronic
956736617 3:72243467-72243489 AGAAAAGAGGCTCTGTCCTTTGG - Intergenic
959452198 3:106517664-106517686 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
959520159 3:107316399-107316421 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
962864902 3:139440325-139440347 TGGAGGGACAGTCTGTCCTGAGG + Intergenic
962926000 3:139993922-139993944 TGGAAGTAGGGCCAGTCCTTGGG + Intronic
962997667 3:140647589-140647611 AGGATGGAGGGTCTGTTCTATGG + Intergenic
963341402 3:144038968-144038990 TTCTAAGAGGGTCTGTCCTTTGG + Intronic
964255622 3:154771975-154771997 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
965273624 3:166652714-166652736 TGCAAGCAGGGTTTATCCTTAGG + Intergenic
965288287 3:166844518-166844540 TGGAACTAGGGTCAGTCCATGGG - Intergenic
966929866 3:184669436-184669458 TGGCAGGAGGGACTGGACTTGGG + Intronic
967543156 3:190692748-190692770 TGGAAGGAGGAACTTTTCTTTGG + Intergenic
969374319 4:6753184-6753206 TGGAGGGCGGGGCTGCCCTTTGG + Intergenic
969685562 4:8672171-8672193 TGGGAGGAGGGGCTGTCCAGTGG + Intergenic
970346990 4:15161946-15161968 GGGAAGGAGGGTTTGTTGTTTGG + Intergenic
970905400 4:21210293-21210315 TGGAAGGAGGAGCTGTGTTTTGG + Intronic
971368119 4:25993848-25993870 TTGAAGGCGGGGCTGTCCTGGGG - Intergenic
973157121 4:46969931-46969953 TGGAGGGAGGGTGTGATCTTAGG - Intronic
973574580 4:52273876-52273898 AGGAGGGAGGGTCTGTTCTGTGG - Intergenic
974184573 4:58430056-58430078 AGGAGAGAGGGTCTGTCCTGTGG + Intergenic
975222272 4:71826408-71826430 TAGAAGGAGGGTCAGACATTAGG - Intergenic
975503840 4:75116963-75116985 TGGAAGGAAGGGGTGTCTTTTGG - Intergenic
977649497 4:99453842-99453864 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
978683698 4:111414611-111414633 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
979546837 4:121950079-121950101 TGGAGGGAAGGTATATCCTTTGG - Intronic
979568125 4:122179971-122179993 TGGAAGAAGTGCCTGTCTTTTGG - Intronic
979595062 4:122525615-122525637 TGGAAGGAAGGAGTGTCTTTTGG + Intergenic
979803405 4:124939831-124939853 TGGAAACAGTGTCAGTCCTTTGG + Intergenic
979915036 4:126420929-126420951 TGCAGGATGGGTCTGTCCTTCGG + Intergenic
983593579 4:169441480-169441502 AGGCAGGAGGGCCTGTCCTCAGG - Intronic
986705202 5:10448790-10448812 TGGAAGGCGGGGCTGGCCTTTGG + Intronic
987235495 5:15937554-15937576 GGGAGGGAGGGTGTGGCCTTGGG - Exonic
988479852 5:31620462-31620484 AGGAAGCGGGGTGTGTCCTTGGG + Intergenic
988716068 5:33829573-33829595 TAGAAGGAGGATCTGACCATTGG + Intronic
988781847 5:34529544-34529566 ATGTAGGAGGGCCTGTCCTTGGG + Intergenic
989515480 5:42337764-42337786 TGACAGGTGGGCCTGTCCTTGGG - Intergenic
991700493 5:69312466-69312488 TGCGAGGGGTGTCTGTCCTTTGG - Intronic
993105638 5:83597312-83597334 TGGAGGGAGGGTATTTACTTTGG + Intergenic
993450879 5:88070709-88070731 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
994176645 5:96718850-96718872 GGGAAGGAAGGTCTGTCATGAGG + Intronic
995187870 5:109290450-109290472 GGGATGGAGGGTCTGTGCTGTGG - Intergenic
996683738 5:126257260-126257282 GGTAGGGAGGGCCTGTCCTTAGG - Intergenic
997271324 5:132540725-132540747 AGAATGGAGGGTCTCTCCTTTGG + Intergenic
999229699 5:150054374-150054396 TGGAAGGTGGGTCTGTGGGTGGG + Exonic
1000243235 5:159427868-159427890 TCTTAGGAGGGGCTGTCCTTGGG + Intergenic
1001477036 5:172057837-172057859 TGGAGGGAGGGGACGTCCTTGGG + Intronic
1001629485 5:173164106-173164128 TGGGAGGAAGGTCTGGCATTGGG + Exonic
1001686908 5:173600132-173600154 TGGAAGGAGGGGCTGTCCAGTGG + Intergenic
1002280022 5:178124481-178124503 TGGAGGGAGGGGCTGCCCTGAGG - Exonic
1003339770 6:5208661-5208683 TGGAAGGAATGTCTCTCATTTGG - Intronic
1003378049 6:5597262-5597284 TGGAAGGTGTGGCTGTCTTTGGG + Intronic
1003887678 6:10535845-10535867 AGCAGGGAGGGTCTGTCTTTCGG - Intronic
1006425431 6:33960198-33960220 GGGAGGGAGGGTCTGGCCTCAGG - Intergenic
1007428976 6:41765463-41765485 TGGGAGGAGGGTCTCTGCTGGGG - Intergenic
1007612714 6:43160810-43160832 CTGAAGGAGGGCCGGTCCTTGGG - Exonic
1008211491 6:48729796-48729818 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1008328576 6:50217773-50217795 TGGAAGGTGAATCTGCCCTTAGG - Intergenic
1008976231 6:57430158-57430180 TGAAATTGGGGTCTGTCCTTGGG + Intronic
1009164754 6:60327298-60327320 TGAAATTGGGGTCTGTCCTTGGG + Intergenic
1012091403 6:94902532-94902554 TGGAAGGAAGGGTTGTCTTTTGG - Intergenic
1012394431 6:98779807-98779829 TGGAGAGAGGGTGAGTCCTTTGG + Intergenic
1014124429 6:117760110-117760132 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1014936684 6:127394083-127394105 TGGGAGGATCGTCTGTGCTTGGG - Intergenic
1015104021 6:129515357-129515379 TGGAAAGAGGAGCTGTCGTTGGG - Intronic
1017535948 6:155348567-155348589 AGGATGGAGGGTCTGTGCTATGG + Intergenic
1018128935 6:160709562-160709584 AGGCAGGAGGGTGTGTGCTTGGG - Intronic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1019488841 7:1301679-1301701 TGGGAGGAGGCTCTGTCTCTGGG + Intergenic
1020914238 7:14172045-14172067 TGGAAGGAGGGGTTGTGCTCAGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1023886335 7:44359949-44359971 AGGATGGAGGGTCTGTGCTATGG + Intergenic
1026637385 7:72096291-72096313 AGGAAGTAAAGTCTGTCCTTAGG - Intronic
1027269009 7:76510313-76510335 GGGGAGGAGGGTCTGGCTTTTGG - Intergenic
1028082950 7:86600290-86600312 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1028176915 7:87671113-87671135 AGGATGGAGGGTCTGTACTGTGG + Intronic
1030314912 7:108104644-108104666 TTGAAAGAGGGCTTGTCCTTGGG + Intronic
1030389432 7:108907569-108907591 TAGAAGAAGGGACAGTCCTTGGG - Intergenic
1032150163 7:129422168-129422190 TGGAAGGAGGGTGAGCCATTGGG + Intronic
1033601497 7:142892125-142892147 TGGAAGGTGGGTCCAACCTTGGG + Intergenic
1034352619 7:150427371-150427393 GAGGAGAAGGGTCTGTCCTTGGG - Intergenic
1035026477 7:155830007-155830029 TGGAAGGAGGGGACGGCCTTTGG - Intergenic
1035884569 8:3278042-3278064 TGCCAGGAGGGCTTGTCCTTGGG - Intronic
1037743346 8:21624510-21624532 TGGAAGCTGGGTGTGTCCATGGG - Intergenic
1037909949 8:22738352-22738374 TGGAGCGGGGGTCTGGCCTTGGG + Intronic
1039780012 8:40775800-40775822 TGGAAGCAGGGTCTGTCAGGAGG + Intronic
1039919680 8:41884466-41884488 TGGAAGAAGTGCCTGTCCTGAGG - Intronic
1041245897 8:55888245-55888267 TGGAAGAAGGGGCTTTCCTGAGG + Intronic
1043229828 8:77788040-77788062 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1044591543 8:93917581-93917603 TGGATGGAGGGGCTGGCCCTCGG + Intronic
1045358554 8:101411357-101411379 TGGCAGGAAGGTGTGTCCTGGGG + Intergenic
1046357540 8:113107720-113107742 TGGATGGAGGCTGTGTTCTTGGG + Intronic
1046557242 8:115790320-115790342 TGGAAGGAGGGAGTCTCTTTAGG - Intronic
1046949163 8:120003437-120003459 TGGGAGGAGGGCATGACCTTGGG + Intronic
1047073992 8:121379003-121379025 TGGAAGCAGGCTCTGGCCTTTGG + Intergenic
1048271895 8:133035986-133036008 GGGAAGGAGGGAGTGTGCTTAGG - Intronic
1048573967 8:135676629-135676651 AGGAAGGAGGGGCTCTCCCTGGG - Intergenic
1049450535 8:142659179-142659201 TGAAAGGAAGGCCTGTCCTCTGG - Intronic
1050391358 9:5147216-5147238 AGGATGGAGGGTCTGTGCTGTGG + Intronic
1052236706 9:26219401-26219423 TGGAAGGGTGAGCTGTCCTTTGG + Intergenic
1052695232 9:31869441-31869463 AGGTAGGAGAGTTTGTCCTTGGG + Intergenic
1055373703 9:75626022-75626044 TGGAAGAAGTGTGGGTCCTTTGG + Intergenic
1057247492 9:93469088-93469110 TGAAAGGAGGGGCTGGCCCTGGG - Intronic
1057594373 9:96402342-96402364 TTGCAGGAGGCTCTGTTCTTAGG - Intronic
1058171497 9:101686782-101686804 AGGACAGAGGGTCTGCCCTTAGG - Exonic
1060050748 9:120376525-120376547 TGGTAGGAGGGGCTGGCCTAGGG - Intergenic
1060316330 9:122514837-122514859 TGCAAGGAATCTCTGTCCTTAGG - Intergenic
1061412793 9:130430365-130430387 GCGAAGGAGGGTCTGGCCTGGGG - Exonic
1061485999 9:130920782-130920804 TGGAACAGGGGTCTGTCCTCTGG + Intronic
1061758503 9:132833134-132833156 TTGAAGGCGGGTCTGTCCTACGG + Intronic
1186030301 X:5361529-5361551 TAAAAGATGGGTCTGTCCTTTGG + Intergenic
1186402738 X:9274550-9274572 GGAAAGGAGGGTCTATCCATAGG - Intergenic
1187342804 X:18436420-18436442 GGGTTGGAGAGTCTGTCCTTGGG + Intronic
1187529242 X:20081586-20081608 AGGAAGAAGGGGCTGTCCTCAGG - Intronic
1187867365 X:23736070-23736092 TGGGAGGAGGGTAGGTCTTTAGG - Intronic
1188068935 X:25695561-25695583 TGGAAGGAGGGGGTCTCTTTTGG + Intergenic
1190823038 X:53992617-53992639 GGGTAGGAGGGACTGTACTTAGG - Intronic
1191576711 X:62714289-62714311 TGGGGGGAGGGGCTGGCCTTGGG - Intergenic
1191988904 X:67010716-67010738 AGGATGGAGGGTCTGTGCTATGG - Intergenic
1193943765 X:87707767-87707789 AGGTAGGAGAGTCTGTCCTTGGG + Intergenic
1194137215 X:90161085-90161107 AGGATGGAGGGTCTGTGCTCTGG + Intergenic
1194781425 X:98029142-98029164 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1195172352 X:102281617-102281639 TGGAAGGAAGGGGTCTCCTTCGG + Intergenic
1195186509 X:102405476-102405498 TGGAAGGAAGGGGTCTCCTTCGG - Intronic
1195629708 X:107042208-107042230 AGTAAGAAGTGTCTGTCCTTGGG + Intergenic
1196152611 X:112391956-112391978 AGGATGGAGGGTCTGTGTTTGGG + Intergenic
1196227903 X:113188425-113188447 AGGATGGAGGGTCTGTGCTGTGG + Intergenic
1196582987 X:117396948-117396970 AGGATGGAGGGTCTGTGCTGTGG - Intergenic
1199159980 X:144597381-144597403 TGAAAGGAAGGTGTCTCCTTTGG + Intergenic
1200397108 X:155997782-155997804 GGGAAGGTGAGTCTGTGCTTTGG + Exonic
1200482948 Y:3731008-3731030 AGGATGGAGGGTCTGTGCTCTGG + Intergenic