ID: 1114660338

View in Genome Browser
Species Human (GRCh38)
Location 14:24339604-24339626
Sequence GAGGGGTGTCGCCCACTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114660336_1114660338 -8 Left 1114660336 14:24339589-24339611 CCGCTGGGCCTGAGAGAGGGGTG 0: 1
1: 1
2: 3
3: 49
4: 456
Right 1114660338 14:24339604-24339626 GAGGGGTGTCGCCCACTAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1114660325_1114660338 21 Left 1114660325 14:24339560-24339582 CCTCGATGGACACCAAGGGGGCG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1114660338 14:24339604-24339626 GAGGGGTGTCGCCCACTAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1114660320_1114660338 27 Left 1114660320 14:24339554-24339576 CCAGTTCCTCGATGGACACCAAG 0: 1
1: 0
2: 1
3: 13
4: 78
Right 1114660338 14:24339604-24339626 GAGGGGTGTCGCCCACTAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1114660330_1114660338 9 Left 1114660330 14:24339572-24339594 CCAAGGGGGCGGGGGCACCGCTG 0: 1
1: 0
2: 1
3: 23
4: 254
Right 1114660338 14:24339604-24339626 GAGGGGTGTCGCCCACTAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114660338 Original CRISPR GAGGGGTGTCGCCCACTAGC CGG Intronic