ID: 1114662902

View in Genome Browser
Species Human (GRCh38)
Location 14:24360021-24360043
Sequence CTGAATATACAGATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114662900_1114662902 25 Left 1114662900 14:24359973-24359995 CCTAGCATGGTGTATGGCACATA No data
Right 1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114662902 Original CRISPR CTGAATATACAGATGGAAAA TGG Intergenic
No off target data available for this crispr