ID: 1114667017

View in Genome Browser
Species Human (GRCh38)
Location 14:24384042-24384064
Sequence CCACTCTCCAAGCCTATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114667017_1114667024 27 Left 1114667017 14:24384042-24384064 CCTGACATAGGCTTGGAGAGTGG No data
Right 1114667024 14:24384092-24384114 ACGTGAAGTTAGCCAATCACAGG No data
1114667017_1114667025 30 Left 1114667017 14:24384042-24384064 CCTGACATAGGCTTGGAGAGTGG No data
Right 1114667025 14:24384095-24384117 TGAAGTTAGCCAATCACAGGAGG No data
1114667017_1114667022 1 Left 1114667017 14:24384042-24384064 CCTGACATAGGCTTGGAGAGTGG No data
Right 1114667022 14:24384066-24384088 CAGGGATGGTTTCCTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114667017 Original CRISPR CCACTCTCCAAGCCTATGTC AGG (reversed) Intergenic
No off target data available for this crispr