ID: 1114668271

View in Genome Browser
Species Human (GRCh38)
Location 14:24394264-24394286
Sequence CATTATTCACTATGGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114668271_1114668274 4 Left 1114668271 14:24394264-24394286 CCAACCTGCCATAGTGAATAATG No data
Right 1114668274 14:24394291-24394313 AAATAATATCCTTGCTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114668271 Original CRISPR CATTATTCACTATGGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr