ID: 1114668824

View in Genome Browser
Species Human (GRCh38)
Location 14:24398437-24398459
Sequence TGTCCCTAGACTTCAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114668817_1114668824 -8 Left 1114668817 14:24398422-24398444 CCGCCAGCTCCAAGCTGTCCCTA No data
Right 1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG No data
1114668813_1114668824 22 Left 1114668813 14:24398392-24398414 CCTGGGGGGCTTCAGGAGGGTCT No data
Right 1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG No data
1114668807_1114668824 30 Left 1114668807 14:24398384-24398406 CCTCCAGCCCTGGGGGGCTTCAG No data
Right 1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG No data
1114668809_1114668824 27 Left 1114668809 14:24398387-24398409 CCAGCCCTGGGGGGCTTCAGGAG No data
Right 1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG No data
1114668812_1114668824 23 Left 1114668812 14:24398391-24398413 CCCTGGGGGGCTTCAGGAGGGTC No data
Right 1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG No data
1114668816_1114668824 -7 Left 1114668816 14:24398421-24398443 CCCGCCAGCTCCAAGCTGTCCCT No data
Right 1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114668824 Original CRISPR TGTCCCTAGACTTCAGTGGG GGG Intergenic
No off target data available for this crispr