ID: 1114668867

View in Genome Browser
Species Human (GRCh38)
Location 14:24398586-24398608
Sequence TCCCAAGAGAACGGGGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114668867_1114668886 15 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668886 14:24398624-24398646 GTTGGGGGTAGGGGGGAGGTGGG 0: 1
1: 2
2: 43
3: 640
4: 8737
1114668867_1114668891 25 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668891 14:24398634-24398656 GGGGGGAGGTGGGGGTAAAGGGG 0: 1
1: 0
2: 10
3: 169
4: 1508
1114668867_1114668873 -10 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668873 14:24398599-24398621 TCTCTTGGGACGCCTGGGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1114668867_1114668883 8 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668883 14:24398617-24398639 AGAGGCTGTTGGGGGTAGGGGGG 0: 1
1: 2
2: 13
3: 141
4: 1170
1114668867_1114668879 4 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668879 14:24398613-24398635 TGGGAGAGGCTGTTGGGGGTAGG 0: 1
1: 0
2: 0
3: 86
4: 714
1114668867_1114668877 0 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668877 14:24398609-24398631 CGCCTGGGAGAGGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 24
4: 290
1114668867_1114668885 14 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668885 14:24398623-24398645 TGTTGGGGGTAGGGGGGAGGTGG 0: 1
1: 2
2: 209
3: 7535
4: 10800
1114668867_1114668880 5 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668880 14:24398614-24398636 GGGAGAGGCTGTTGGGGGTAGGG 0: 1
1: 0
2: 5
3: 57
4: 596
1114668867_1114668884 11 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668884 14:24398620-24398642 GGCTGTTGGGGGTAGGGGGGAGG 0: 1
1: 2
2: 29
3: 520
4: 10006
1114668867_1114668875 -2 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668875 14:24398607-24398629 GACGCCTGGGAGAGGCTGTTGGG 0: 1
1: 0
2: 0
3: 23
4: 184
1114668867_1114668882 7 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668882 14:24398616-24398638 GAGAGGCTGTTGGGGGTAGGGGG 0: 1
1: 1
2: 4
3: 82
4: 777
1114668867_1114668876 -1 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668876 14:24398608-24398630 ACGCCTGGGAGAGGCTGTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1114668867_1114668890 24 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668890 14:24398633-24398655 AGGGGGGAGGTGGGGGTAAAGGG 0: 1
1: 0
2: 7
3: 114
4: 1045
1114668867_1114668888 17 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668888 14:24398626-24398648 TGGGGGTAGGGGGGAGGTGGGGG 0: 1
1: 4
2: 66
3: 522
4: 4267
1114668867_1114668874 -3 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668874 14:24398606-24398628 GGACGCCTGGGAGAGGCTGTTGG 0: 1
1: 0
2: 2
3: 30
4: 270
1114668867_1114668889 23 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668889 14:24398632-24398654 TAGGGGGGAGGTGGGGGTAAAGG 0: 1
1: 0
2: 4
3: 89
4: 943
1114668867_1114668887 16 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668887 14:24398625-24398647 TTGGGGGTAGGGGGGAGGTGGGG 0: 1
1: 1
2: 33
3: 325
4: 2457
1114668867_1114668881 6 Left 1114668867 14:24398586-24398608 CCGAGGTCCCCGTTCTCTTGGGA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1114668881 14:24398615-24398637 GGAGAGGCTGTTGGGGGTAGGGG 0: 1
1: 1
2: 8
3: 80
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114668867 Original CRISPR TCCCAAGAGAACGGGGACCT CGG (reversed) Intergenic
903002666 1:20277389-20277411 TACCAAAAGAACCAGGACCTTGG - Intergenic
905905966 1:41618702-41618724 TCCCAAGACAAAAGGGACCTTGG + Intronic
906783389 1:48592444-48592466 TACCCAGAGAACTGGGAGCTTGG - Intronic
908442453 1:64169131-64169153 TCCAAAGAGAAAAAGGACCTGGG + Intronic
909129871 1:71721450-71721472 ACCAATGAGAACAGGGACCTTGG - Intronic
911527460 1:99004432-99004454 TACCACGAGCACGGGGACCCCGG + Exonic
912468859 1:109892847-109892869 TCCCAAGCTAAAGGGCACCTTGG - Intergenic
912488713 1:110049301-110049323 GCCCACAAGAACGGGGGCCTTGG + Intronic
914894907 1:151661024-151661046 TTCAAAGAGAAAGTGGACCTAGG - Intronic
915449338 1:155993931-155993953 TCCCAGGAGAAAGGGAGCCTGGG - Intronic
915599309 1:156912656-156912678 TCCCCAGGGAACTGGGACCTAGG + Intronic
915910390 1:159911442-159911464 TCCCAAGAACACTGGGACCCTGG + Intergenic
915971258 1:160356782-160356804 TCCCAAGGGAAAGGGGCCCCAGG - Intronic
916340946 1:163734218-163734240 TCCCAAGAGAAAGGAGATATAGG - Intergenic
1063001513 10:1928575-1928597 GGCCAAGAGAAAGGGAACCTGGG + Intergenic
1063457157 10:6191915-6191937 CCCCCAGAGAACGGCGACCAGGG - Intronic
1069609698 10:69764729-69764751 TCCCAAGGGACAAGGGACCTGGG + Intergenic
1069683204 10:70299895-70299917 TCCCAAGAGACAAGAGACCTGGG + Exonic
1069821802 10:71233095-71233117 TGCCAAGAGAACAGGGATCAAGG + Intronic
1071572989 10:86708195-86708217 TGCCAGGAGAGCTGGGACCTGGG + Intronic
1073243464 10:102073287-102073309 ACCCAGAAGAAAGGGGACCTGGG + Intergenic
1073466396 10:103696842-103696864 TCCCAGGAAAACAGGGACATGGG + Intronic
1077095571 11:797673-797695 CCCCAAGAGGACGGGGACAGCGG - Exonic
1077466571 11:2736371-2736393 TCCCCAGAGGCCTGGGACCTGGG - Intronic
1077532792 11:3105106-3105128 GCCCCAGGGAACGGGGACCCTGG + Intronic
1078095258 11:8292582-8292604 TGCCAAGAGACCTGGGTCCTGGG + Intergenic
1078645972 11:13141688-13141710 TCCCAATAGAAGGGTGAACTCGG - Intergenic
1079647258 11:22881044-22881066 TCCCAAGAAAACTGGAACTTTGG + Intergenic
1082958922 11:58900776-58900798 TCCTAAGAGAATGGGAAGCTTGG + Intronic
1082974440 11:59058457-59058479 TCCTAAGAGAATGGGAAGCTTGG + Intergenic
1082978849 11:59102250-59102272 TCCTAAGAGAATGGGAAGCTTGG + Intergenic
1083194863 11:61079857-61079879 TCCCAGGTGTATGGGGACCTGGG - Intergenic
1083923517 11:65792841-65792863 TCCCAGGAGGACAGGGACATGGG - Intronic
1085466694 11:76728814-76728836 TCCCCAGAGAACAGTCACCTTGG + Intergenic
1088114538 11:106300035-106300057 TCCCAAAAGAGAGGGCACCTGGG + Intergenic
1089413226 11:118264639-118264661 TCCCAAGTGAATGTGGCCCTGGG - Intergenic
1098444440 12:70551766-70551788 CCTCAAGAGAAAGGGAACCTAGG - Intronic
1103293447 12:119866222-119866244 TCCCAAGAGGACTGGGGCATTGG - Intronic
1105764629 13:23547081-23547103 CCCCAAGGGAGCGGGGACCGCGG - Intergenic
1106122142 13:26869218-26869240 TCCTAAGAAAACGGGGATGTGGG - Intergenic
1113664004 13:112128288-112128310 TCCCAGGAGAACGGCGAGGTAGG - Intergenic
1113788540 13:113015510-113015532 TCCCAAGAGCACCGCGTCCTCGG - Intronic
1114668867 14:24398586-24398608 TCCCAAGAGAACGGGGACCTCGG - Intergenic
1118786254 14:69047745-69047767 TCCCAAGAGAACTGTGAATTAGG - Intergenic
1119163435 14:72472081-72472103 TCCCGAGAGAGCCGAGACCTAGG + Intronic
1119387232 14:74265296-74265318 TGCCATGAGAACAGGGAACTTGG - Intergenic
1120832104 14:89006646-89006668 TCCCAAGAGAAGAGTGACTTTGG + Intergenic
1120960983 14:90124582-90124604 CCACAAGGAAACGGGGACCTCGG + Intronic
1121506448 14:94481425-94481447 CCCAAAGAGAAAGGGCACCTTGG + Intergenic
1121634223 14:95442901-95442923 TCCCAGGAGAGCAGGGGCCTGGG + Intronic
1125999534 15:44195623-44195645 TCCCAAGAGGGCGGGAACCGCGG - Intergenic
1129966317 15:79738971-79738993 TCCCAAGAGAAAGAAAACCTGGG - Intergenic
1136396138 16:29993540-29993562 TCCCTAGGGAAGGGGTACCTGGG + Exonic
1137404148 16:48176742-48176764 TCCCATGATCACAGGGACCTTGG + Intronic
1139961781 16:70722115-70722137 TCCCAGGAGAGTGGGGGCCTTGG - Intronic
1141424672 16:83937073-83937095 GCCCAAGATGAGGGGGACCTAGG - Intronic
1141841071 16:86574519-86574541 TCCCAAGAGAAGGGAGGCCCTGG + Intergenic
1142231209 16:88901104-88901126 TCCAGAGAGAACGTGGAACTCGG - Intronic
1142586608 17:978735-978757 TCCCCGGGGACCGGGGACCTGGG - Intronic
1142738075 17:1914197-1914219 TCCGAGGAGCACGGGGCCCTGGG + Intergenic
1144659924 17:17061334-17061356 TCCAAAGAGAAAGGATACCTGGG - Intronic
1145303745 17:21658116-21658138 TCCCAAGAGAACTGTGAATTTGG + Intergenic
1145346290 17:22043726-22043748 TCCCAAGAGAACTGTGAATTTGG - Intergenic
1146009027 17:29179717-29179739 TCCCAAGAGGAGGGGGCCCAGGG + Intronic
1146694225 17:34896658-34896680 GCCCAAGACAGCTGGGACCTGGG + Intergenic
1147045732 17:37750682-37750704 TCCCAAGAGCACAGGACCCTGGG + Intergenic
1147176750 17:38660582-38660604 GCCCCAGAGAGTGGGGACCTGGG - Intergenic
1147332131 17:39705424-39705446 TCCCAAGAGAAACAGGAGCTGGG - Intronic
1150291981 17:63987471-63987493 TCCCCAGGGAGCGGGGGCCTTGG + Intergenic
1152086744 17:78224517-78224539 TCCAAAGAAAGCGGGGACCTGGG - Exonic
1152286208 17:79414708-79414730 CCCCAAGAGGATGGGCACCTGGG + Intronic
1155524249 18:26700328-26700350 TCCCAGGAGAACAGGGACTCTGG + Intergenic
1159943081 18:74424156-74424178 TCCCAAGAGAAAGGGGACATGGG - Intergenic
1161504517 19:4636593-4636615 TCCCAGTAGAGCTGGGACCTGGG + Intergenic
1161707542 19:5829210-5829232 TCCCCAGAGACCTGGGTCCTCGG + Intergenic
1162587347 19:11568358-11568380 GGCCATGAGAACGGGGTCCTTGG + Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1165469361 19:35994536-35994558 TCCCAAGGGCACGGGGCACTGGG - Intergenic
1165592594 19:36982966-36982988 TCCCAGGAGAACTGTGGCCTTGG + Intronic
1167299981 19:48672632-48672654 TCCAGAGAGAAAGGGGACATGGG - Intronic
1167719864 19:51171984-51172006 TCCCAAGACAACTTGGACATTGG - Intergenic
926592425 2:14753703-14753725 TCCCAGCAGAAAAGGGACCTAGG + Intergenic
927268180 2:21176558-21176580 TCCCAAATGAATGGGGACATTGG + Intergenic
927848549 2:26484736-26484758 TCCCTAGAGTCCCGGGACCTGGG + Intronic
929923786 2:46192922-46192944 ACCCAAAAGGACAGGGACCTGGG + Intergenic
934941562 2:98506765-98506787 TCACAAGAGGAAGGGGTCCTGGG + Intronic
936502134 2:113074762-113074784 CCCCAGGAAAATGGGGACCTTGG - Exonic
937897885 2:126992220-126992242 TGGCAAGAGCATGGGGACCTCGG - Intergenic
938929796 2:136076701-136076723 TGACAAGCGAACGGGGACCCCGG - Intergenic
940018680 2:149133896-149133918 TCCCCAGAGAACAGGAACCATGG - Intronic
941915188 2:170807913-170807935 TCCTAAGAAAACAGGGACTTTGG - Intergenic
948787820 2:240362288-240362310 CCCTAAGAGAACAGAGACCTTGG + Intergenic
948837069 2:240631030-240631052 TCCCAAGAGAGCAGGTACCTGGG - Exonic
1171521272 20:25775764-25775786 TCCCAAGAGAACTGTGAATTTGG + Intronic
1171555538 20:26080100-26080122 TCCCAAGAGAACTGTGAATTTGG - Intergenic
1176655106 21:9580875-9580897 TCCCAAGAGAACTGTGAATTTGG + Intergenic
1181931171 22:26402858-26402880 TCCCAAGGAAAGGGGGAGCTGGG - Intergenic
1182414218 22:30210588-30210610 TCCCCAGAGCCCGGGGAGCTGGG + Intergenic
1184093596 22:42304934-42304956 CCCCAAGAGTACGGGGCCCCTGG - Intronic
1184258266 22:43299474-43299496 TCCCCAGAGAAGGGCGACCTGGG - Intronic
1184509945 22:44927473-44927495 TCCCCAGATAATGGGGACTTTGG - Intronic
1184600356 22:45539632-45539654 AGCCAAGTGAACGGGGACCTTGG + Intronic
950679946 3:14578237-14578259 GACCAAGAGCACAGGGACCTGGG + Intergenic
951638234 3:24804276-24804298 TCCTGAGAGTACAGGGACCTGGG - Intergenic
952861134 3:37813059-37813081 TCCCAAGTGTAGGGGGACTTTGG + Intronic
954105614 3:48408359-48408381 TCCCAAGCCAACTGAGACCTGGG + Intronic
956241449 3:67135236-67135258 CCCCAAGAGAAAGGAGATCTGGG - Intergenic
957553768 3:81739570-81739592 TCTCAAGAGCACTGGGACCTAGG + Intronic
963056234 3:141188471-141188493 TCCCCAGTGAACAGGAACCTAGG - Intergenic
970809773 4:20078844-20078866 TCCTAACAGACCGGGGACCTGGG + Intergenic
984729056 4:183049019-183049041 TCCCTGGAGAACAGGGACCTGGG - Intergenic
985644021 5:1076666-1076688 CCCCCACAGGACGGGGACCTGGG - Intronic
987017690 5:13836999-13837021 ACCTAAGACAATGGGGACCTGGG + Intronic
990756132 5:59072497-59072519 TCCCTAGACAAGGGGGGCCTAGG - Intronic
993014930 5:82524650-82524672 TCCTAAAAGAACAGGGACCCAGG + Intergenic
997895006 5:137708590-137708612 CCCCATGAGGACAGGGACCTTGG - Intronic
999855877 5:155593241-155593263 ATCCAAGAGAACGGAGCCCTTGG + Intergenic
1001913057 5:175536952-175536974 ACGCAAGTGAAGGGGGACCTGGG - Intergenic
1002641547 5:180632947-180632969 CCCCAGGAGGACAGGGACCTGGG - Intronic
1004790244 6:19017711-19017733 TCTTAAGAGAACAGGGCCCTAGG + Intergenic
1008030544 6:46688793-46688815 TCGCGAGAGAACCGGGACCCCGG - Exonic
1014065262 6:117117311-117117333 TCCCTGGAGAACAGGCACCTTGG - Intergenic
1017561990 6:155637989-155638011 TCCAGAGAGAACGTGGCCCTGGG + Intergenic
1025281740 7:57630721-57630743 TCCCAAGAGAACTGTGAATTTGG + Intergenic
1025302989 7:57834796-57834818 TCCCAAGAGAACTGTGAATTTGG - Intergenic
1026246153 7:68621563-68621585 TCCCAATAGAAGGGGAAACTGGG - Intergenic
1026775283 7:73227306-73227328 TCCCAAGAGAAGAGGGACCCGGG - Intergenic
1027016140 7:74780677-74780699 TCCCAAGAGAAGAGGGACCCGGG - Intronic
1027071888 7:75165260-75165282 TCCCAAGAGAAGAGGGACCCGGG + Intergenic
1037838257 8:22227234-22227256 TCCCAAGAGAACGGGGTGTCAGG - Intronic
1039037584 8:33376552-33376574 TCCCAAGAGAAAGGAGGACTTGG - Intronic
1039479056 8:37858337-37858359 TTCCAAGAGGTCTGGGACCTTGG + Intergenic
1040108026 8:43550991-43551013 TCCGAAGGGAGCGGGGAGCTTGG - Intergenic
1049662291 8:143824855-143824877 TCAGGAGAGAACTGGGACCTGGG - Intronic
1052059544 9:23943370-23943392 TCCCAAGAGCATGGGGTTCTTGG + Intergenic
1052295127 9:26889552-26889574 TCCCAAGAAAATAGGGAACTCGG + Intronic
1056580814 9:87887153-87887175 TCCCAGGAAAATGGGAACCTTGG - Exonic
1059135643 9:111803526-111803548 TCCCCAGAGACAGGGGACCAGGG - Intergenic
1203632828 Un_KI270750v1:84328-84350 TCCCAAGAGAACTGTGAATTTGG + Intergenic
1187740498 X:22350218-22350240 TCCTCAGAGACCTGGGACCTAGG + Intergenic
1190874368 X:54449255-54449277 TCCCTACAGAACGTGGATCTTGG - Exonic
1195311396 X:103634815-103634837 TCCTAAGAGCAGGGGGACCCTGG - Intergenic
1199654325 X:149979802-149979824 TGCCAAGTGAACAGGGCCCTGGG + Intergenic