ID: 1114670848

View in Genome Browser
Species Human (GRCh38)
Location 14:24410158-24410180
Sequence AAACCAGGGGTTGCGGCGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114670836_1114670848 9 Left 1114670836 14:24410126-24410148 CCCTTCGAGCTGAACCTGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1114670833_1114670848 28 Left 1114670833 14:24410107-24410129 CCACGAGGCCCTGAATACACCCT 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1114670838_1114670848 8 Left 1114670838 14:24410127-24410149 CCTTCGAGCTGAACCTGTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1114670834_1114670848 20 Left 1114670834 14:24410115-24410137 CCCTGAATACACCCTTCGAGCTG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1114670842_1114670848 -5 Left 1114670842 14:24410140-24410162 CCTGTCAGGGGAACCTGGAAACC 0: 1
1: 0
2: 1
3: 9
4: 170
Right 1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1114670835_1114670848 19 Left 1114670835 14:24410116-24410138 CCTGAATACACCCTTCGAGCTGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114670848 Original CRISPR AAACCAGGGGTTGCGGCGAG TGG Exonic
904019296 1:27450071-27450093 GAAGCAGAGGTTGCGGTGAGTGG + Intronic
905618043 1:39414442-39414464 AATCCAGCGGTTGCAGCCAGAGG - Exonic
905779158 1:40692278-40692300 AGGCGTGGGGTTGCGGCGAGAGG + Intronic
920203555 1:204275527-204275549 AACCCAGGGGTTGGGGGGTGGGG + Intronic
920290726 1:204921272-204921294 AAAACAGGAGTTGCTGGGAGTGG - Intronic
923700557 1:236296221-236296243 GAAGCAGAGGTTGCGGTGAGCGG - Intergenic
1068821643 10:61383666-61383688 AAAACAGGGGTTGGGGTGTGTGG - Intergenic
1069852750 10:71421005-71421027 AAACCAAGGGTTGGGGGGAAAGG - Intronic
1070114565 10:73516343-73516365 CAACCAGGGGTTGGGGGGAGGGG - Intronic
1078474572 11:11620277-11620299 AAAGCAGGGGGCGCGGGGAGGGG + Intronic
1080790098 11:35514815-35514837 AAACCAGGGGGTGTGGTGCGGGG - Intronic
1082177732 11:49081116-49081138 AAAGCAGAGGTTGCAGTGAGCGG + Intergenic
1085944073 11:81245051-81245073 AAACCAGTGGTGGCAGCCAGAGG - Intergenic
1090028798 11:123189929-123189951 AAGGCAGGGGTTGCAGTGAGTGG + Intronic
1097354624 12:58587265-58587287 GAACCAGGGGTTTAGGCCAGGGG - Intronic
1100685191 12:96979833-96979855 AAACCAGAAGCTGCCGCGAGAGG + Intergenic
1103731641 12:123031762-123031784 AAACCAGGTATTGCCGGGAGAGG - Intronic
1103863888 12:124036085-124036107 AAATCAGGGGTTGTGTGGAGTGG - Intronic
1104037924 12:125111027-125111049 AACCCAGGGGTGGGAGCGAGGGG + Intronic
1104412555 12:128571560-128571582 TTACCAGGGGCTGCGGGGAGGGG - Intronic
1104467304 12:129000787-129000809 ATAGCAGGGGTGGGGGCGAGAGG + Intergenic
1106887048 13:34198505-34198527 GAAGCCGAGGTTGCGGCGAGTGG - Intergenic
1107634696 13:42380557-42380579 AAACCAGGGCTGGCAGTGAGTGG - Intergenic
1113378920 13:109786088-109786110 CGCCCAGGGGTTGGGGCGAGGGG + Exonic
1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG + Exonic
1118726212 14:68630769-68630791 AAACCAGGGGTTGGTTCAAGGGG - Intronic
1119479528 14:74950920-74950942 AAATGAGGGGTTGCTGGGAGAGG - Intronic
1121451281 14:94009734-94009756 AAAACAGGGGTGGTGGTGAGAGG + Intergenic
1126688305 15:51267243-51267265 GAGGCAGGGGGTGCGGCGAGCGG + Intronic
1129082273 15:73052045-73052067 AGCCGAGGGGCTGCGGCGAGCGG + Intronic
1129896343 15:79109923-79109945 AGGCCAGGGGTTGTGGGGAGTGG + Intergenic
1132344289 15:101098938-101098960 TAGCCAGGGGCTGCGGGGAGGGG + Intergenic
1134615494 16:15648508-15648530 AAGGCAGAGGTTGCGGTGAGTGG - Intronic
1136400176 16:30012609-30012631 ACTCCAGGGACTGCGGCGAGAGG + Intronic
1136453957 16:30370102-30370124 AACCCCGGGGCGGCGGCGAGGGG + Exonic
1138160408 16:54747798-54747820 AAACCAAGGCTTGTGGCGGGGGG - Intergenic
1138354354 16:56365716-56365738 AGAGCAGGGGTTGCGGTGGGCGG - Intronic
1144653888 17:17023349-17023371 CTACCAGGGGCTGCGGGGAGGGG + Intergenic
1146971915 17:37080286-37080308 TTACCAGGGGTTGTGGGGAGAGG - Intergenic
1147403622 17:40195376-40195398 AAGCCAGGGGCTGCAGGGAGAGG - Exonic
1147740916 17:42670515-42670537 AAACCAGGGGTTCAGGCTTGGGG + Intronic
1148235227 17:45964354-45964376 AAAACAGGGGGTGGGGGGAGGGG - Intronic
1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG + Intergenic
1150290657 17:63979640-63979662 AACCCAGGGGTGGAGGCAAGTGG - Intergenic
1152097466 17:78280220-78280242 ATGCCAGGGGCTGCGGCCAGGGG + Intergenic
1152220850 17:79064674-79064696 GAGGCAGGGGTTGCGGTGAGTGG + Intergenic
1155161493 18:23199672-23199694 TAACCAGGGGTTAGGGCAAGAGG + Intronic
1159947915 18:74457473-74457495 GGAGCAGGGGATGCGGCGAGTGG - Intronic
1160910831 19:1473065-1473087 AAACGTGGGGTGGCGGCTAGGGG - Exonic
1160913698 19:1487071-1487093 AAACCAGGAGGGGCGGGGAGGGG + Intronic
1161436629 19:4267545-4267567 TGAGCAGGGGTTGTGGCGAGGGG + Intronic
1161735669 19:5990805-5990827 AAAACAGGGGTGGCGGCGGTTGG + Intergenic
1165876140 19:39008192-39008214 GAACCAGAGGTTGCAGTGAGCGG + Intronic
1165925323 19:39322507-39322529 GAAGCAGAGGTTGCGGTGAGCGG - Intergenic
1165939376 19:39407608-39407630 AACCCAGGGGTTTCTGCGGGCGG + Intronic
1166543894 19:43622992-43623014 AAACCAGGTCTTGTGGGGAGGGG - Exonic
1166873155 19:45882866-45882888 AAAGCAGGGGTTAAGGGGAGGGG - Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167456831 19:49600793-49600815 AAGGCAGAGGTTGCGGTGAGCGG - Intronic
925451331 2:3972321-3972343 AAACCAGGGGAAGAGGCGTGGGG + Intergenic
925915502 2:8601596-8601618 ACACCAGGGGGTGTGGGGAGTGG + Intergenic
925957686 2:8984224-8984246 AGGCCAGGGGTTGGGGTGAGGGG + Intronic
930259456 2:49127961-49127983 GAAGCAGAGGTTGCGGTGAGTGG - Intronic
931552739 2:63464867-63464889 TTACCAGGGGTTGAGGGGAGGGG + Intronic
932914917 2:75846698-75846720 AAAACAGGGGTAGAGGGGAGAGG + Intergenic
932947531 2:76253773-76253795 TTACCAGGGGTTGGGGCGTGGGG + Intergenic
936469631 2:112787333-112787355 AAAACGGGGGTTGCGGAGAAGGG + Intergenic
940887227 2:159000416-159000438 GAAACAGTGGTTGCGGGGAGTGG + Intronic
942318162 2:174713179-174713201 GAACCAGGGGTTGGGGGTAGGGG + Intergenic
946176580 2:217925797-217925819 TAACCAGGGGTTTGGGGGAGGGG - Intronic
947398641 2:229711851-229711873 AAACCTGGGGTGGTGGGGAGGGG - Intronic
1169200953 20:3709890-3709912 TAACCAGGGGCTGCAGGGAGGGG + Intergenic
1172370587 20:34387230-34387252 GAAGCAGAGGTTGCAGCGAGGGG + Intronic
1175571946 20:60030064-60030086 AAACCAGGGGTTGTGGGGGAAGG - Intronic
1178486451 21:33022838-33022860 TGACCAGGGGTGGCGGCGGGAGG - Intergenic
1178973008 21:37197851-37197873 ATAACAGGGGTGGCGGGGAGGGG - Intronic
949568830 3:5271620-5271642 AAATAAGGGGTTGGGGAGAGGGG - Intergenic
950548626 3:13653550-13653572 AATCCAGGGGTTGCAGCGGAAGG + Intergenic
950583607 3:13878677-13878699 ACCGCAGGGGCTGCGGCGAGGGG - Intronic
955235816 3:57138082-57138104 TAGCCAGGGGCTGCGGGGAGAGG + Intronic
956393084 3:68795450-68795472 AAATCAGTGGTTGTGGCTAGGGG - Intronic
957902284 3:86510198-86510220 ATACCAGGGGCTGAGGAGAGGGG + Intergenic
958979075 3:100699066-100699088 ACACTGGGGGTTGCGGGGAGGGG + Intergenic
959287835 3:104439653-104439675 AACTCAGGGGTTGTGGGGAGAGG - Intergenic
961177821 3:124850537-124850559 AAACCATGGGGTGGGGGGAGGGG + Intronic
961442665 3:126962094-126962116 GAACCAGGGGTTGCAGGCAGAGG - Intergenic
961625944 3:128263897-128263919 AAACAAGGGGATGTGGGGAGAGG - Intronic
963015485 3:140820415-140820437 AAAGAAGGGGTTGGGGGGAGAGG + Intergenic
963917653 3:150874122-150874144 AATCCAGGGGCTGAGGCGGGAGG - Intronic
966969512 3:185030357-185030379 AAACCAGGGGTTGCTCAGAGAGG - Intronic
968039150 3:195573842-195573864 AAACCAGGAGTTGAGGTGAGTGG - Exonic
971682995 4:29725572-29725594 AAATCAGTGGTAGCGGAGAGAGG - Intergenic
976692487 4:87883675-87883697 AACCCAGAGGTTGAGGCGGGGGG + Intergenic
982758712 4:159254677-159254699 AAGACAGGGGTTGCAGTGAGCGG - Intronic
983704072 4:170636190-170636212 AAACCAGGGGTGGAGGTGACTGG + Intergenic
986021442 5:3807826-3807848 GAACCAGGGGTTGGGGGTAGTGG - Intergenic
986710227 5:10483315-10483337 AAACCAGGGATTACGTCTAGAGG + Intergenic
990737860 5:58883139-58883161 TAACCAGGGGCTGCGGAGGGAGG - Intergenic
992562808 5:77968990-77969012 AGACCAGGGGTTGGGGCGGGGGG + Intergenic
993510044 5:88759409-88759431 GAAGCAGAGGTTGCGGTGAGTGG + Intronic
995886430 5:116899729-116899751 AAACCAGGGGTTGAAGCAGGAGG - Intergenic
999462422 5:151769383-151769405 AAGGCAGAGGTTGCGGCAAGCGG - Intronic
1000626668 5:163547003-163547025 AAAGTAGAGGTTGCAGCGAGCGG - Intergenic
1003551788 6:7107545-7107567 AAACCTGGGGCTGCGGTGGGGGG + Intergenic
1003809478 6:9763971-9763993 AAACCAGGGGTTGAGGATATGGG - Intronic
1006030125 6:31171911-31171933 AAACCAGGGGGTGGGGGGTGTGG + Intronic
1007112591 6:39321637-39321659 AAACCAGGTGTTGTGGAGGGAGG - Intronic
1007929376 6:45676631-45676653 AAACCACGGGTTGGGGTGAGGGG + Intergenic
1009994508 6:70883550-70883572 TAACCAGGGGCTGAGGGGAGGGG + Intronic
1014986005 6:128010492-128010514 GAACTATGGGTTGCGGGGAGGGG - Intronic
1017177711 6:151520254-151520276 GAAACAGGGGTTGCTGTGAGAGG + Intronic
1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG + Intergenic
1019488006 7:1298295-1298317 AAACCAGGGGCTGTGGGGACAGG + Intergenic
1020113321 7:5460522-5460544 AAGGCAGAGGTTGCGGTGAGCGG - Intronic
1021019084 7:15573983-15574005 AAACCAGTGGGTGGGGCGTGGGG + Intergenic
1023769040 7:43537948-43537970 CAACCAGGGGGTGTGGCGACGGG - Intronic
1032792735 7:135254304-135254326 AAGTCAGGGGTTGCTGCCAGAGG + Intronic
1034745988 7:153524315-153524337 AGACCAGGGGCTGAGGCCAGTGG + Intergenic
1035042007 7:155935897-155935919 AGACCAGGGGCTGCAGAGAGAGG + Intergenic
1038410708 8:27356881-27356903 AAACTAGGGGTTGTGGAGATGGG + Intronic
1047578575 8:126186460-126186482 AAATCAGGGGTGGTGGTGAGGGG - Intergenic
1047742102 8:127814841-127814863 ATACCAGGGGATGAGGGGAGGGG - Intergenic
1049361519 8:142214378-142214400 AAATCCGGGGTGGCGGGGAGAGG - Intronic
1053118827 9:35530020-35530042 GAAGCAGAGGTTGCGGTGAGTGG - Intronic
1056658687 9:88529188-88529210 AAATCAGGGGCAGCGGGGAGGGG + Intergenic
1059480349 9:114584572-114584594 TAACCAGGGGCTGAGGGGAGAGG - Intergenic
1062496922 9:136836318-136836340 AGCCCCGGGGTTGCGGCCAGTGG + Intronic
1189350268 X:40270640-40270662 AAACCACGAGTTGAGGGGAGCGG - Intergenic
1197485746 X:127049371-127049393 GAGCCAGGGGTTGCAGTGAGTGG - Intergenic
1197826375 X:130594668-130594690 AAAGCAGGGGATGCGGGGCGGGG + Intergenic