ID: 1114671005

View in Genome Browser
Species Human (GRCh38)
Location 14:24411059-24411081
Sequence GTCCCACGACCCCACAGGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114670996_1114671005 24 Left 1114670996 14:24411012-24411034 CCCAGGGCTGGCTCTGAGGGAGG 0: 1
1: 0
2: 2
3: 71
4: 466
Right 1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG 0: 1
1: 0
2: 0
3: 14
4: 141
1114670998_1114671005 23 Left 1114670998 14:24411013-24411035 CCAGGGCTGGCTCTGAGGGAGGA 0: 1
1: 0
2: 4
3: 55
4: 467
Right 1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG 0: 1
1: 0
2: 0
3: 14
4: 141
1114670995_1114671005 25 Left 1114670995 14:24411011-24411033 CCCCAGGGCTGGCTCTGAGGGAG 0: 1
1: 0
2: 5
3: 53
4: 469
Right 1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG 0: 1
1: 0
2: 0
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114671005 Original CRISPR GTCCCACGACCCCACAGGCA TGG Exonic
902714257 1:18261636-18261658 GACCTAAGACCTCACAGGCAGGG - Intronic
902714290 1:18261807-18261829 GCCCCCCGACCCCTCAGACAAGG + Intronic
903970924 1:27118297-27118319 GTGCCACCTACCCACAGGCAGGG - Intronic
907083639 1:51648480-51648502 GACCCACTACCCCACAGGGCAGG - Intronic
907089355 1:51709879-51709901 GTCCAACATCCTCACAGGCATGG + Intronic
911642946 1:100308248-100308270 GTCCCAAAACCTCACAGGTAGGG + Intergenic
912442848 1:109712317-109712339 GTCCCAGTACCCCAGAGTCATGG - Exonic
917556574 1:176096443-176096465 GTCCAACGACCACACAGGGCGGG + Intronic
922225773 1:223645035-223645057 GTCCCAAAACCCCAAAAGCAGGG + Intronic
922825337 1:228513612-228513634 CACCCATGACCCCACAGCCACGG - Intergenic
1065767029 10:29039661-29039683 TTCCCAACACCCCACAAGCAAGG - Intergenic
1066381482 10:34905698-34905720 GACCCCTGACCCCTCAGGCACGG + Intergenic
1067183010 10:44004877-44004899 GTCCCACGTCTCCACAGTCAGGG + Intergenic
1068774476 10:60855646-60855668 GCCCCAATACCCCGCAGGCAGGG - Intergenic
1069389235 10:67915019-67915041 TTCCCAAGACACCACAGGCAGGG - Intronic
1070757656 10:79003447-79003469 GTCCCTTGAGCCCACAGGCTTGG - Intergenic
1075276293 10:121095903-121095925 GTGCCAGGACCACACAGGCAAGG + Intergenic
1077094394 11:793166-793188 GACAGACGGCCCCACAGGCAGGG + Intronic
1077755521 11:5024354-5024376 CTCCCTAGACCCCAAAGGCAAGG - Intergenic
1081773793 11:45664826-45664848 GTCCCACGACCCGCCTGGCTCGG - Intronic
1083158735 11:60841751-60841773 GTCCGAGGAGCCCATAGGCAAGG - Intergenic
1084406192 11:68974996-68975018 GGACCACGACTCCAGAGGCAGGG + Intergenic
1084446646 11:69207469-69207491 GTCCCATCACCTCACAGGGATGG - Intergenic
1084481134 11:69420831-69420853 GGCCCACATCCCCACAGGCCTGG - Intergenic
1084749305 11:71193731-71193753 GTCCCACGCCCCCGGAGGCCAGG + Intronic
1085691516 11:78667981-78668003 GTCCCAGGGTCCCACAGGCAGGG - Intronic
1085699648 11:78734730-78734752 GTTCCACTGCCCCACACGCATGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089614019 11:119685176-119685198 ATCCCATGAGCCCACAGTCAGGG + Intronic
1090275029 11:125413083-125413105 GCCCCACGCCCCCAGAGGCGAGG - Intronic
1090972071 11:131652700-131652722 GTCCCGCTGCCCAACAGGCAGGG - Intronic
1093899900 12:24619978-24620000 CTCCCACTCCCCGACAGGCATGG + Intergenic
1096113797 12:49043494-49043516 GTCCCACAGCCCTACAGGCCAGG + Intronic
1102581224 12:113889341-113889363 CTCTCAGGAACCCACAGGCAAGG + Intronic
1104727063 12:131084671-131084693 GTCCCGCGACCCCTGAGGCCTGG - Intronic
1105635354 13:22210726-22210748 GTCACACGGCCTCACAGGCTGGG - Intergenic
1106036162 13:26047254-26047276 GTCCTAAGACCCTACAGGCATGG + Intronic
1106350336 13:28923775-28923797 GCTCTAGGACCCCACAGGCAAGG - Intronic
1106665610 13:31847300-31847322 TTCCCACGTGCCCACACGCAGGG - Intergenic
1113439430 13:110316252-110316274 GTCCCATTACTCCACAGTCAGGG - Intronic
1113906127 13:113819997-113820019 TTCCCGCGTCCCCACTGGCAGGG - Intergenic
1113943606 13:114031823-114031845 GTCCCACCCTCCCACAGGCAGGG - Intronic
1114499035 14:23154421-23154443 CACCCACGCCCCCACAGGCCCGG - Intronic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1120909092 14:89649286-89649308 GGCACACAACCCCACAGGGACGG + Intergenic
1121434815 14:93912125-93912147 GTCTCAGCACCCCACAGGCCTGG - Intergenic
1121615640 14:95311769-95311791 GTCCCATGAACCCACAGGGTAGG - Intronic
1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG + Intronic
1124963242 15:34413708-34413730 GCCCCACGACCACACACGCCAGG - Intronic
1124979864 15:34559934-34559956 GCCCCACGACCACACACGCCAGG - Intronic
1125751489 15:42032377-42032399 TGCCCACCACCCCACAGGGAAGG + Intronic
1126681830 15:51209759-51209781 TTCCCATGACCCCAAAGCCAAGG - Exonic
1128994196 15:72284895-72284917 TCCCCTCCACCCCACAGGCATGG - Exonic
1133113180 16:3561817-3561839 GTCCCACCCGCCCACGGGCAGGG + Intronic
1138150607 16:54653235-54653257 GTACCACCTCCACACAGGCATGG + Intergenic
1138533368 16:57646924-57646946 CAACCACGGCCCCACAGGCAAGG - Intronic
1139750726 16:69107446-69107468 TTCCCACGACCCAACCGGGAAGG - Intronic
1141426568 16:83947992-83948014 GTCCCAGGAACCCCCAGGCCTGG - Intronic
1142983012 17:3682184-3682206 CTCCCCCGATCCCACAGGCCAGG + Intronic
1144482953 17:15642678-15642700 GTCCCACACCCTCACAGGCCTGG + Intronic
1144915729 17:18722353-18722375 GTCCCACACCCTCACAGGCCTGG - Intronic
1147824461 17:43261528-43261550 GTGGCAGGACCCCAGAGGCATGG + Intergenic
1147829828 17:43291647-43291669 GTGGCAGGACCCCAGAGGCAGGG + Intergenic
1148130905 17:45262164-45262186 CCGCCGCGACCCCACAGGCAGGG + Intergenic
1152539442 17:80967606-80967628 CTGCCACCACCCAACAGGCAGGG - Intergenic
1156545479 18:37960086-37960108 TTCCCACAATCCCACAGGCCTGG + Intergenic
1160178877 18:76617580-76617602 CTCCCACGAGACCGCAGGCATGG - Intergenic
1160702597 19:515215-515237 TCCCCACAATCCCACAGGCAAGG - Intronic
1162935529 19:13979801-13979823 GTGCCAAGAACCCGCAGGCAAGG + Intronic
1165080696 19:33304410-33304432 CTCCCACAACTCCACAGGCCGGG - Intergenic
1167072669 19:47230151-47230173 GTCCACCCACCCCACAAGCAGGG + Intronic
1167860211 19:52277078-52277100 GTGCCACAACCACACACGCAGGG - Intronic
1167973005 19:53200547-53200569 GTGCCACGACCACACACACAGGG - Intergenic
925089284 2:1140583-1140605 CTCCAGCGCCCCCACAGGCAGGG + Intronic
925284875 2:2709349-2709371 ATGCCACAACCTCACAGGCATGG - Intergenic
926162952 2:10501261-10501283 GTCCCACCTCCCCACTGGCCCGG - Intergenic
927684422 2:25160976-25160998 CTGCCACGACCCCCCAGGCTGGG + Exonic
932497705 2:72154656-72154678 GTCCCAGGACCCCAGGGCCAGGG + Intergenic
936095608 2:109528504-109528526 GTCCCAGGACCCCGCTGGAAGGG + Intergenic
936578391 2:113674225-113674247 GTTCAAGGACCACACAGGCAGGG + Intergenic
938331897 2:130453920-130453942 GTCATACGACCCCTGAGGCATGG + Intergenic
938357778 2:130665934-130665956 GTCATACGACCCCTGAGGCATGG - Intergenic
947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG + Intronic
947745883 2:232507065-232507087 CTCCCTGGACCCCACAGGCCCGG + Intergenic
948485507 2:238278550-238278572 TTCCCAGCACCCCACAGGCCGGG - Intronic
948632735 2:239312408-239312430 GGCCCAGGAGCCCACACGCAGGG + Intronic
949027520 2:241773545-241773567 TTCCTTGGACCCCACAGGCAAGG + Intergenic
1171459553 20:25291070-25291092 GGCCCACAACCCCACTGGCCTGG - Intronic
1173822451 20:46028436-46028458 GTCCCTGGAGCCCACAGCCAGGG - Intronic
1175242725 20:57561658-57561680 GTCCCAGCACCCTGCAGGCAGGG + Intronic
1175735011 20:61379271-61379293 GACCCAGCACCCCACAGCCAAGG - Intronic
1175785716 20:61710583-61710605 GCCCCAGGGCCCCAGAGGCAGGG - Intronic
1176191221 20:63811088-63811110 GTCCCAGAACCCCACAGGATGGG + Intronic
1176191264 20:63811214-63811236 GTCCCAGAACCCCACAGGATGGG + Intronic
1178906586 21:36642035-36642057 GCCCCAGGAGTCCACAGGCAGGG - Intergenic
1180693888 22:17739728-17739750 GCACCACGTCCCCACAGGCAGGG + Intronic
1183512307 22:38243404-38243426 GTCCCCCGACCACACAGGAGAGG + Intronic
1184302296 22:43568760-43568782 GTCCCATGTCCCCAAGGGCAGGG - Intronic
1184968457 22:47998059-47998081 ATGCCACCACCGCACAGGCAGGG - Intergenic
1185028361 22:48428204-48428226 ATCACAGGACCCCACAGGCCTGG - Intergenic
1185314123 22:50171437-50171459 GGCCCTCCACCCCTCAGGCAGGG + Intronic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
961789884 3:129368083-129368105 GACCCACGAGGTCACAGGCACGG - Intergenic
962385915 3:134932552-134932574 GACCCAAGATCACACAGGCAGGG - Intronic
963770732 3:149383865-149383887 GGCACCTGACCCCACAGGCATGG - Intergenic
967989836 3:195122612-195122634 GTCCTTCGACTCCACAGGAAGGG + Intronic
968082034 3:195853162-195853184 ATCCCTCGACGGCACAGGCATGG + Intergenic
968913224 4:3486129-3486151 GTCCTGAGACCCCACAGCCAGGG - Intronic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969735002 4:8982240-8982262 GTGTCACCACCCCACAGGAATGG + Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
982259993 4:153486776-153486798 GTTCCACCACTCCACAGGCGTGG - Intronic
984750079 4:183263820-183263842 GAGCCACCACCCCACATGCAGGG - Intronic
987664238 5:20916089-20916111 GTCCCAAAACCTCAAAGGCAGGG + Intergenic
995324613 5:110875755-110875777 GTCCCAAAACCTCAAAGGCAGGG + Intergenic
996096256 5:119402127-119402149 GTCCCTTGACCCCTCAGGCCAGG + Intergenic
997363253 5:133308846-133308868 GTCCGGTGACCACACAGGCAGGG - Intronic
997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG + Intronic
998136663 5:139677688-139677710 GTCCCAGGACCTCAGAGGCTGGG + Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
999311636 5:150555333-150555355 GACCCAGGCCCCCACAGGCTGGG - Exonic
1001004976 5:168042180-168042202 GCCCCAAGACCCAGCAGGCATGG + Intronic
1001570221 5:172725905-172725927 GTCCCAGGGCCCCAAAGACAGGG + Intergenic
1002942310 6:1728710-1728732 GTCTAAAGACCCCTCAGGCACGG - Intronic
1004399996 6:15279477-15279499 CTTCCACGACCCCAGAGGCCAGG - Intronic
1007246737 6:40468704-40468726 CTCCCACCACCTCACAGGCATGG - Intronic
1008518089 6:52337086-52337108 GTCCCAAGACCACTCAGGCTGGG - Intergenic
1020272947 7:6607776-6607798 GAGCCAGGACCCCACAGGCGAGG - Intronic
1023362499 7:39430977-39430999 CTCCTGTGACCCCACAGGCAAGG - Intronic
1023847237 7:44129300-44129322 TGTCCACGCCCCCACAGGCATGG + Intergenic
1024561295 7:50647742-50647764 CTCCCATGACGACACAGGCAAGG + Intronic
1026134472 7:67647246-67647268 GTCCCAAAACCTCACAAGCAGGG + Intergenic
1028148490 7:87345497-87345519 GTCCCACTACCGCGCAGGCCCGG + Intergenic
1029597569 7:101545804-101545826 GGCTCACAACCCCAAAGGCAGGG - Intronic
1030634982 7:111938546-111938568 GTGCCACCTCCCCACAGGCTTGG - Intronic
1033534697 7:142300898-142300920 CTCCCATGGCCCCACAGGCAAGG - Intergenic
1034436546 7:151065285-151065307 CTCCCACTACACCACAGGCAGGG - Intronic
1034898078 7:154890327-154890349 GTCCCTCCCTCCCACAGGCAGGG - Intronic
1034936409 7:155203378-155203400 GTCCCATGTCCCCAGAGTCAGGG + Intergenic
1040016881 8:42707176-42707198 GTCCCAGCACCTCAGAGGCATGG - Intronic
1048319801 8:133389590-133389612 GACCCAAGGTCCCACAGGCAGGG + Intergenic
1049684400 8:143933585-143933607 GGCCCAGGACCCCACAGACATGG - Intronic
1051343676 9:16133610-16133632 GACCCCAGACCCGACAGGCAGGG - Intergenic
1052647495 9:31254707-31254729 GTCCAACGCCCTCAAAGGCATGG + Intergenic
1054452567 9:65411099-65411121 GACCCTCGAGGCCACAGGCAAGG + Intergenic
1060049925 9:120371356-120371378 GTCCCCCTTCCCCAAAGGCAAGG + Intergenic
1061371491 9:130200171-130200193 GTCCCGCGCTCACACAGGCAGGG + Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1061746389 9:132743250-132743272 GTCGGGCGGCCCCACAGGCACGG + Intronic
1062431040 9:136526991-136527013 CTGCCACGGCCCCACAGCCACGG + Intronic
1185601379 X:1342027-1342049 GTAATACGACCTCACAGGCAGGG + Intronic
1185620682 X:1451133-1451155 GTCCCAGGACCCCCTAGGAATGG - Intronic
1185620696 X:1451168-1451190 GTCCCAGGACCCCCTAGGGATGG - Intronic
1187791359 X:22953499-22953521 TTCCCACCACCCCACATCCATGG - Intergenic
1192561890 X:72132585-72132607 GTGCCAGGATCCCAAAGGCATGG - Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic