ID: 1114672764

View in Genome Browser
Species Human (GRCh38)
Location 14:24420622-24420644
Sequence GCCCATGGTGCAGGGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114672749_1114672764 28 Left 1114672749 14:24420571-24420593 CCAACAAACAAATACAGTTCAGG No data
Right 1114672764 14:24420622-24420644 GCCCATGGTGCAGGGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114672764 Original CRISPR GCCCATGGTGCAGGGGCCTG GGG Intergenic
No off target data available for this crispr