ID: 1114672831

View in Genome Browser
Species Human (GRCh38)
Location 14:24421186-24421208
Sequence ATAAGCTATCTGGTGAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114672826_1114672831 -6 Left 1114672826 14:24421169-24421191 CCCCTGTTAAAACTTACATAAGC No data
Right 1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG No data
1114672825_1114672831 -1 Left 1114672825 14:24421164-24421186 CCGTGCCCCTGTTAAAACTTACA No data
Right 1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG No data
1114672823_1114672831 5 Left 1114672823 14:24421158-24421180 CCTATCCCGTGCCCCTGTTAAAA No data
Right 1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG No data
1114672827_1114672831 -7 Left 1114672827 14:24421170-24421192 CCCTGTTAAAACTTACATAAGCT No data
Right 1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG No data
1114672828_1114672831 -8 Left 1114672828 14:24421171-24421193 CCTGTTAAAACTTACATAAGCTA No data
Right 1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG No data
1114672824_1114672831 0 Left 1114672824 14:24421163-24421185 CCCGTGCCCCTGTTAAAACTTAC No data
Right 1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114672831 Original CRISPR ATAAGCTATCTGGTGAAGTT GGG Intergenic
No off target data available for this crispr