ID: 1114673493

View in Genome Browser
Species Human (GRCh38)
Location 14:24427215-24427237
Sequence CTGTGGCTGGTGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 13, 3: 88, 4: 728}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114673493_1114673502 9 Left 1114673493 14:24427215-24427237 CCTTCCTTCCTCACCAGCCACAG 0: 1
1: 0
2: 13
3: 88
4: 728
Right 1114673502 14:24427247-24427269 CCTTCCCACCCTTCTGCCTGTGG 0: 1
1: 0
2: 6
3: 54
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114673493 Original CRISPR CTGTGGCTGGTGAGGAAGGA AGG (reversed) Exonic
900331592 1:2137494-2137516 CAGTGGCTGCGGGGGAAGGAGGG - Intronic
900510588 1:3058399-3058421 GTGTGGCTGCTGCAGAAGGACGG - Intergenic
900879455 1:5370204-5370226 CTGTGGCTGGAGAGAAATGAAGG - Intergenic
900894587 1:5474343-5474365 CTGTGGCTGGTGATGATGGCAGG + Intergenic
901295971 1:8161169-8161191 CTGGGTCTGGTGAAGAAGGAAGG - Intergenic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901646072 1:10717545-10717567 CAGGGGCTGGTGAGGAGGGAGGG - Intronic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902190698 1:14761074-14761096 TGGTGGCTGGTGAGGGAGGCAGG - Intronic
902814485 1:18908380-18908402 CCGTTGGTGGTGTGGAAGGAAGG + Exonic
903407078 1:23106813-23106835 CTGTGGAGGGTGGGGAAGGATGG - Intronic
903739368 1:25549731-25549753 CTGTGGCTGGCGAGTAGGGCGGG + Intronic
903848156 1:26290665-26290687 GTGGGGCTTGAGAGGAAGGAGGG + Intronic
904088845 1:27930411-27930433 ATGGGACTGGTGGGGAAGGAGGG - Intergenic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904227304 1:29033263-29033285 CTGTGTCTGGTTTGGGAGGAAGG - Intronic
904253593 1:29240777-29240799 GAGTGGCTGGGGAGGAGGGAGGG + Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904591252 1:31616796-31616818 CTCTGGCTGGTGGGGGAGGCAGG - Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
905107239 1:35571508-35571530 CTGTGGCTGGGGTTGAGGGAGGG + Intergenic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905340371 1:37273790-37273812 AGGTGGCTGCTGAGGAGGGAGGG - Intergenic
905357561 1:37395369-37395391 CTGTGGCTGGTGAGGTGGAGGGG - Intergenic
905912954 1:41666291-41666313 CTCAGGCTGGAGAGAAAGGATGG - Intronic
906115621 1:43355031-43355053 ATGTGGCTGGGGAGGAATTATGG + Intergenic
906155912 1:43613793-43613815 CTGTGGTGGGTGAGGAAGCAGGG + Intronic
906243850 1:44259407-44259429 ATGTGGCTGATGAGGAAGGCAGG + Intronic
906295639 1:44647422-44647444 CGGAGGCTTGTGAGGAGGGAAGG + Intronic
906661982 1:47589553-47589575 CTGGAGACGGTGAGGAAGGAGGG - Intergenic
906787727 1:48630511-48630533 CTGTGGCTGATGGGAGAGGAAGG - Intronic
906799123 1:48720831-48720853 CTGGGGCTGGGAATGAAGGATGG + Intronic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908522456 1:64957361-64957383 TGGAGGCTGGTGAGGCAGGAAGG - Intronic
908590106 1:65621939-65621961 ATGTGCCTGGTCAGGGAGGATGG + Intronic
910931481 1:92446748-92446770 TGGTGGCTGCTGAGGGAGGAGGG - Intergenic
911049194 1:93655124-93655146 CTGAGGCTGGAGAGGAGGCAGGG + Intronic
911710308 1:101064198-101064220 ATTTAGCTGGTGAGGCAGGATGG - Intergenic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
915279242 1:154810925-154810947 ATGTGGCTGGTGAGGGCAGAGGG - Intronic
915456051 1:156041577-156041599 GCGTGGCTGGTGAGGAAGTGGGG + Exonic
915517938 1:156423973-156423995 CTGGGGCCGGTGAGGAAGAGTGG + Intronic
915661826 1:157411244-157411266 CTGTGCCTGGTGGGCAAGGAAGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916571364 1:166030741-166030763 GTGAGGCTGGAGAGGAAGTAGGG - Intergenic
916827092 1:168452902-168452924 CTGTGTATGTTGAGGAAGAAGGG - Intergenic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
918194902 1:182212122-182212144 TTGTGGAAGGTGGGGAAGGAAGG + Intergenic
918311413 1:183288036-183288058 CTGTGGCTGGTGGGGTGGGAGGG + Intronic
918341386 1:183570594-183570616 CCATGGCTGGTGAGGAAATAAGG - Intronic
918443168 1:184588971-184588993 CTGTGGTTGCTAAGTAAGGAAGG - Intronic
918851209 1:189693002-189693024 CTGGTGCTGGTGAAGGAGGAAGG - Intergenic
919700853 1:200629760-200629782 CTGGGGCTGATGAGGAAAGCAGG + Intronic
919922334 1:202174080-202174102 CTGGGGCTGGGGAGGATGGGTGG + Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
919976970 1:202619108-202619130 CTATGGCTGGGGAGGAATGGCGG + Intronic
920069014 1:203289331-203289353 CACTGGCTCCTGAGGAAGGAAGG + Intergenic
920309201 1:205038655-205038677 ATTTGGCTGGTGTGGAAGGTGGG - Intergenic
920347732 1:205317489-205317511 CTCTGGCTGGTGTGGTGGGATGG - Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
920710463 1:208289618-208289640 CTGTGGCTGATGGTGCAGGATGG - Intergenic
920739736 1:208569150-208569172 CAGAGGCTGGTGAGGGAGGTGGG + Intergenic
921067528 1:211633189-211633211 CTGTGGCTGGACAGGAGAGAAGG + Intergenic
921358906 1:214312568-214312590 CAGCGGCTGGAGAGGAGGGAGGG + Intronic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922545820 1:226456078-226456100 CTGTTGGAGGTGAGGAATGAGGG - Intergenic
922947217 1:229526884-229526906 CTGTGGCTGGTGATGAAAATGGG + Intronic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
924329089 1:242924451-242924473 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924510443 1:244725298-244725320 TTGTGGCTGGGGATGAATGAAGG - Intergenic
1062828386 10:588278-588300 CTGTGGCTGGTGTGGATGTGGGG - Intronic
1063113935 10:3060093-3060115 CAGTGGCTGGCAAGGAAAGAAGG + Intergenic
1063246837 10:4229244-4229266 CTGTGGTTGTTGAGGAACTATGG - Intergenic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063458082 10:6199065-6199087 CTTTGGCTGGTGATGATGGAAGG + Intronic
1063602809 10:7497394-7497416 GTCTTGGTGGTGAGGAAGGAAGG + Intergenic
1065625001 10:27621066-27621088 CTGGGGCTGTTGAAGAAGGCAGG - Intergenic
1065938845 10:30545762-30545784 ATGTGGCTGATGAGGAATGAGGG + Intergenic
1066577208 10:36839271-36839293 CTGGAGCTGGTGAGGAAGGCAGG + Intergenic
1067095575 10:43297391-43297413 ATGTGGCTGTTGAGGAGGGGTGG - Intergenic
1067315354 10:45156082-45156104 CTGTGACTTGAGAGGAAGAAAGG - Intergenic
1068181661 10:53527480-53527502 CTGGGTCTGGAAAGGAAGGAAGG + Intergenic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1069605904 10:69738396-69738418 CTGTGGCTGAGCAGGAAGGGAGG + Intergenic
1069681170 10:70286480-70286502 ATGTGGCTGCTGAGGAAAGAAGG - Intergenic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070404829 10:76085526-76085548 CTGGGGCTGGGGTGGAGGGAGGG + Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070669999 10:78371081-78371103 CTTTGGGTGGTGAGGTTGGAAGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070925816 10:80220852-80220874 CTATGGTGGGGGAGGAAGGAGGG - Intergenic
1071096030 10:81975910-81975932 CTGTGGCTGGCTTGGAAGGAAGG + Intronic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1072427712 10:95343985-95344007 CTGTGGTTGGGGATGAAGGGAGG - Intronic
1072437680 10:95428804-95428826 CTGTCCCTGGTGAGAAGGGAGGG + Intronic
1073070997 10:100793234-100793256 CAGGGGCTGGTGGGGAAGGAGGG - Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073336440 10:102714066-102714088 CTGGGCCTGGAGAGGAAGGCGGG - Intronic
1073337074 10:102717573-102717595 ATGTGGCTTGTGTGGGAGGAGGG + Intronic
1073839288 10:107480001-107480023 CTGTGGCTTGTGAGGAACCTGGG - Intergenic
1074057078 10:109932250-109932272 CTGTGACTGGGGAGGATGGGAGG - Intergenic
1074738768 10:116464352-116464374 CTCTGGCTGGTGAAGCAGCATGG - Intronic
1075668130 10:124245083-124245105 CTGTTGCTGGATGGGAAGGAGGG + Intergenic
1075895345 10:125990109-125990131 CTGTACCTGGGGAGGAGGGAAGG - Intronic
1076030707 10:127155578-127155600 CCGTGTCTGGTGAGGAACAAGGG - Intronic
1076152750 10:128176478-128176500 CTGTGGCTGGTGTGAAGGGTGGG + Intergenic
1076172093 10:128327636-128327658 ATGTGGCTGGGGAGGAAGCAGGG - Intergenic
1076467994 10:130698156-130698178 AAGTGGCTGGTGAGGAGGGGAGG + Intergenic
1076559392 10:131351232-131351254 ATGAGGCTGGGGAGGAGGGAAGG + Intergenic
1076600843 10:131656082-131656104 CTGTGTCTGTTGAGGAGGGGTGG - Intergenic
1076805931 10:132858724-132858746 CTGTGGCTGGTGGGGGTGGGTGG + Intronic
1076872735 10:133201654-133201676 CTGAGGCTGGCGAGGACAGACGG + Exonic
1077134790 11:993125-993147 CTGAGGGTGCTGAGGAAGGCAGG + Intronic
1077353025 11:2101469-2101491 AGGTGGCTGGAGAGGAAAGAGGG - Intergenic
1077368767 11:2171931-2171953 CGGGGGTGGGTGAGGAAGGAGGG + Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077490876 11:2860393-2860415 CTGTGGCATGTGGGCAAGGAGGG - Intergenic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1077894795 11:6446151-6446173 GGGTGACTGGAGAGGAAGGAGGG - Intergenic
1078881654 11:15455854-15455876 GTGTTTCTGGTGAGGCAGGATGG + Intergenic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1079136849 11:17780266-17780288 CTGTGGGTGCTGCGGATGGAAGG - Intronic
1079264679 11:18919891-18919913 CTGTGGATGGAGAGGAATGGGGG + Intergenic
1080407252 11:31990537-31990559 GTGTAGCTGGGGAGGCAGGATGG - Intronic
1080580374 11:33637471-33637493 ATGGGGCTGGAGAGGAAGGCAGG - Intronic
1081199511 11:40199389-40199411 TTGTGGTTGTTGGGGAAGGAGGG + Intronic
1081678279 11:44983886-44983908 ATGTTGCTGGTGGGGAAGGTGGG + Intergenic
1081731783 11:45376817-45376839 TTGTGGCTGGTGATGCAGGCTGG - Intergenic
1082059310 11:47847070-47847092 CTGAGGCTGGAGAGGTAGGCAGG - Intronic
1082877548 11:58003344-58003366 CTGTGGCTGGAGAGATAGGGTGG - Intergenic
1083163315 11:60868771-60868793 CTGAGGCAGCTGAGGAAGGGAGG - Intronic
1083289021 11:61679819-61679841 CTGTCGCCCGTGGGGAAGGATGG + Intergenic
1083608330 11:63992413-63992435 GTGTGGCTGGTGGAGAATGAGGG + Intronic
1084008616 11:66335782-66335804 TAGTGGCTGGAGACGAAGGAGGG + Exonic
1084093334 11:66893851-66893873 GAGAGGGTGGTGAGGAAGGAAGG - Intronic
1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG + Intronic
1084911412 11:72392378-72392400 CTCTGGCTGGTCAGGAAAGCCGG + Intronic
1085044268 11:73344125-73344147 ATGGGGCTGGTGAGGGATGAGGG + Intronic
1085084842 11:73660334-73660356 CAGGGGTTGGGGAGGAAGGAAGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085258389 11:75190298-75190320 CTGTGGCTGGTGAGCCAGCCTGG + Intronic
1085258531 11:75191012-75191034 CTGTGGATGCTGAGGAGAGATGG + Intronic
1085991329 11:81849622-81849644 TTGTGGCTGGAGAGGAGGGAGGG + Intergenic
1086538692 11:87881950-87881972 CTGTGGCAGGAAAGGAAGAATGG - Intergenic
1088036375 11:105321262-105321284 CTCTTGCTGGAGAGGAAAGAGGG + Intergenic
1088526921 11:110766408-110766430 CTGAGGCTGGTAAGTAAAGAAGG + Intergenic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089634016 11:119800869-119800891 CTGTGCATTGTGAGGAAAGAAGG - Intergenic
1089755448 11:120682791-120682813 AGGTGGCTGGTGAGGTAGGGAGG - Intronic
1090321170 11:125844892-125844914 CCCTGCCTGGTGAGGAAGGATGG - Intergenic
1091169249 11:133505873-133505895 CTATGACTGATGAGGAAGGTCGG - Intronic
1091184913 11:133638392-133638414 GTGGGGCTGGTGGGGAGGGAAGG - Intergenic
1091356900 11:134944254-134944276 CTGGGGCTGGGGAGGAAGCCAGG + Intergenic
1091647879 12:2287426-2287448 CCGTGGCTGTTTAGGAAGGTTGG + Intronic
1091833009 12:3563534-3563556 CTGCGGCTGGTCAGGAGTGATGG - Intronic
1092078555 12:5693678-5693700 CAGTGGCTGGAGAAGAAGGAAGG - Intronic
1092147260 12:6223221-6223243 CTGGGGTTGGGGTGGAAGGAGGG + Intronic
1092154272 12:6272330-6272352 CTGTGGGAGGTGGGGAAGGTGGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093256373 12:16873167-16873189 CTCTGGGTGGTGGGGAAGGCTGG - Intergenic
1093889344 12:24500955-24500977 CTGTTGCTGCTGAGGAGGGGAGG - Intergenic
1095970080 12:47895679-47895701 CTGTTGGTGTTGGGGAAGGACGG - Intronic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096072590 12:48783433-48783455 ATGTTGCTGGTAGGGAAGGAAGG + Exonic
1096372624 12:51082072-51082094 CTGTAGCTGGGTTGGAAGGAAGG + Intronic
1096490496 12:52010249-52010271 CTCTGGCTGGGCGGGAAGGAAGG + Intronic
1096509973 12:52122244-52122266 CTGACGCTGATGATGAAGGAAGG + Intergenic
1096517263 12:52163890-52163912 CTGTGCCTGCTGGGGAAGGGAGG + Intergenic
1096650471 12:53059760-53059782 CTGCGGCTGGAGAGGGAGGCTGG + Exonic
1096766684 12:53896749-53896771 CAGTGGTGGGTGTGGAAGGAAGG + Intergenic
1096985816 12:55756364-55756386 CTCTGGTTGGTGAGGAAAGCAGG - Exonic
1097088668 12:56488164-56488186 CTGTGGCTGGGAAGGAGGGGCGG + Exonic
1097209143 12:57351451-57351473 CTGTGGATGGTGAGTACTGAGGG + Intronic
1097231675 12:57516013-57516035 CTGTGGCTGTTGTGGAGCGAGGG - Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101478102 12:105070591-105070613 CTGTGCCTGGGCAGGATGGATGG + Exonic
1102100016 12:110270907-110270929 CCTTGGGGGGTGAGGAAGGAGGG + Intergenic
1102468826 12:113147645-113147667 CAGAGGCTGGTGTGGAGGGAAGG + Intergenic
1102939838 12:116929836-116929858 CAGTGGCTGGCGGGGCAGGATGG - Intronic
1103336055 12:120190611-120190633 CTGGGGCGGGTGGGGAAGGTGGG - Intronic
1103593874 12:122011256-122011278 CTGTGGCTGGTGTCATAGGAAGG - Intergenic
1103906536 12:124330540-124330562 CTGAGGCTGGCGAAGAAGCAAGG + Intronic
1104561509 12:129849636-129849658 CTGTTGCTGGTGAGGAAAGCAGG + Intronic
1104897584 12:132171866-132171888 GTGCGGCTGCTGAGGAAAGAGGG + Intergenic
1105438326 13:20395879-20395901 CTGTGGCTGGTGTGGACAGAAGG - Intergenic
1105453198 13:20518469-20518491 CGGTGGGGGGAGAGGAAGGAGGG + Intronic
1105562078 13:21501777-21501799 CTGTGGCAGGAAAAGAAGGAGGG - Intronic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1105725773 13:23160518-23160540 CTGCGGTCGCTGAGGAAGGACGG + Intergenic
1105746659 13:23383502-23383524 CTGGGGCTGTTCAGGAAGGAGGG - Intronic
1106102905 13:26709840-26709862 CTGTGGCTGGTGAGGAGACCAGG + Intergenic
1106143039 13:27026969-27026991 TTGTGGCAGGTGAGGATGGGTGG - Intergenic
1106313658 13:28575504-28575526 CTGTGGCCGTTGAGGAAGAGAGG - Intergenic
1106574135 13:30958482-30958504 CAGTGACTGCTGAGGAAGGCTGG + Intronic
1106639582 13:31569676-31569698 TTTTGGCTGGTGAGGAAGGCTGG - Intergenic
1106725310 13:32478412-32478434 CTTTGGCTGGGGAGGAAGCCTGG - Intronic
1106780772 13:33057026-33057048 GTGAGGCTGGTGAGGAAGAAGGG + Intronic
1107633815 13:42371760-42371782 GAGAGGCTGGGGAGGAAGGAGGG - Intergenic
1108586356 13:51873566-51873588 GTGTGGCTGGAGCAGAAGGATGG - Intergenic
1108629418 13:52267018-52267040 CTGGGGCCTGTCAGGAAGGAGGG - Intergenic
1108656637 13:52539470-52539492 CTGGGGCCTGTCAGGAAGGAGGG + Intergenic
1109072503 13:57787301-57787323 CCCTGTCTGGTGAGGAGGGATGG + Intergenic
1112397216 13:99043900-99043922 CTGAGGCTGGTGTGGAGGGATGG - Intronic
1112558426 13:100490722-100490744 CTGTGGCTGGCCAGGGAGCAGGG - Intronic
1112641068 13:101275653-101275675 CTGTAGCTGGGGAGGAAGAAGGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113376639 13:109770178-109770200 CTGTGGCTGGCAGGAAAGGAGGG + Intronic
1113577508 13:111404644-111404666 CTGTGGCTGGTGGGGAGAGGAGG - Intergenic
1113785884 13:113001956-113001978 CTGTGGCTGCTGCTGAAGGCCGG + Intronic
1114407553 14:22470887-22470909 GTGAGGCTGGGGAGGAAGCAAGG - Intergenic
1114547706 14:23514431-23514453 CTTTTGCTGGGGTGGAAGGAGGG + Intergenic
1114650201 14:24279912-24279934 CTGTGGGTCCTGGGGAAGGATGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115646193 14:35369791-35369813 GTGGAGCTGGTGCGGAAGGAGGG - Intergenic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1118600321 14:67467449-67467471 CTGTGGGTGGGAAGGAGGGAGGG + Intronic
1119726906 14:76926952-76926974 CTCAGGCAGCTGAGGAAGGAAGG - Intergenic
1119741291 14:77015278-77015300 CTGTGGCTGGTGGGAGAGGGAGG + Intergenic
1119744504 14:77034199-77034221 CTGTGCCTGGTTGGGATGGATGG + Intergenic
1120145696 14:80976218-80976240 CTGTGGCTGTTGTGGAAGTGAGG - Intronic
1120163560 14:81170413-81170435 CTGTGGCTGGTGCGCAAGCGCGG + Intergenic
1120955622 14:90079475-90079497 CTGTGGCTGGTGGGGTAGAGGGG + Intronic
1121265371 14:92599058-92599080 GTGTGGCTGGTGTGAAAGGGAGG + Intronic
1121718726 14:96094814-96094836 CTGAGGCTGCTGAGGATGAAGGG + Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122145424 14:99685757-99685779 CTGTGGCTGGTGACATAGGGAGG + Intronic
1122235410 14:100328518-100328540 ATGTGGCTGCCGAGGAAGCATGG + Intronic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122605860 14:102947381-102947403 CTGTGGCAGGTTAGGCATGAAGG - Intronic
1122941828 14:104984933-104984955 GTCTGGCTGGTGACAAAGGAGGG + Intergenic
1202905737 14_GL000194v1_random:71634-71656 CTGTGCCAGGTGAGCAAGGTAGG - Intergenic
1202862412 14_GL000225v1_random:90762-90784 CGGTGGCTGGTGAGGTGGGAGGG + Intergenic
1123502610 15:20903493-20903515 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1123559858 15:21477160-21477182 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1123596095 15:21914459-21914481 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1124693513 15:31845185-31845207 CAGTGCCTGGGGAGGAGGGATGG - Intronic
1124972012 15:34496771-34496793 CTGGGGCTGGACCGGAAGGACGG - Intergenic
1125536475 15:40443308-40443330 CTGAGGCTTGTGAGAAAGGTAGG + Intronic
1125557446 15:40598060-40598082 CTCTGGCGGGTGAGGCAGGAAGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126118842 15:45233208-45233230 CTCTGCCTGGAGGGGAAGGAAGG + Intergenic
1126668350 15:51094487-51094509 CTGGGGCTGGGGAGGACGGGAGG - Intronic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1128513575 15:68328062-68328084 CTGGGGGTGGGGAGAAAGGAGGG + Intronic
1128520956 15:68374604-68374626 CTGTGTCTGTTGAGGCAGGCAGG + Intronic
1129669559 15:77599695-77599717 TAGTGGCTGGCGAGGAGGGATGG - Intergenic
1130659375 15:85818142-85818164 GTGTGGGTGGTGGGGAAGGAGGG - Intergenic
1131055071 15:89370231-89370253 CGTTGGCCGGTGAGGGAGGAAGG - Intergenic
1131097861 15:89667229-89667251 CTGGGGCTGGTGGGGAGGGAAGG - Intronic
1131878558 15:96837823-96837845 CTGGGGATGGTGATGAGGGACGG + Intergenic
1132230814 15:100182522-100182544 CTGTGGCTGCTGTTGAAGGGTGG + Intronic
1132406528 15:101544628-101544650 CTGTTTTTGGTGGGGAAGGAGGG - Intergenic
1202968202 15_KI270727v1_random:204322-204344 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1132911949 16:2318307-2318329 GTGGGGCAGGTGAGGAAGGAAGG - Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1134095043 16:11413467-11413489 CTGTGGCTCTTGGAGAAGGAGGG + Intronic
1134906124 16:17981310-17981332 CAGTGGATGGGCAGGAAGGATGG - Intergenic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1135967615 16:27049007-27049029 GTGAGGCTGGAGAGGTAGGAGGG - Intergenic
1136034831 16:27531247-27531269 GTGTGGCTGGATAGGAAGGTAGG - Intronic
1137670256 16:50274438-50274460 CTGTGGTTGGTGGGGGAGGCTGG + Intronic
1137673921 16:50294500-50294522 CTATGGAGGCTGAGGAAGGACGG + Intronic
1137740044 16:50760433-50760455 CTGTGACTAGTGAGAAACGAAGG - Intronic
1137763075 16:50956315-50956337 CTGAGGCAGGTGACGAATGATGG - Intergenic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1139484849 16:67249552-67249574 CTGTCGCTGGTGAGGATGTGTGG + Intronic
1139544881 16:67645425-67645447 CTGCGGCCAGCGAGGAAGGAGGG - Intronic
1139650459 16:68359647-68359669 CTTTGCCTGGTGAGGCTGGAGGG - Exonic
1139837879 16:69854299-69854321 ATGTGGATGGCGAGGAAAGAGGG + Intronic
1140061323 16:71572319-71572341 CTCTGGCTGGAGAGAAAGAAAGG + Exonic
1140692616 16:77498833-77498855 CAGAGGCGGGGGAGGAAGGAAGG + Intergenic
1141009529 16:80384574-80384596 CTGTAGCTTGGAAGGAAGGAAGG + Intergenic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141790067 16:86228253-86228275 CTGTGGCTTATGAGGAGGGAAGG + Intergenic
1142052079 16:87965394-87965416 CTGGGGCTGGAGGGGCAGGAGGG + Intronic
1142135233 16:88448973-88448995 CTGTGGCTGCTGCTGTAGGAGGG + Intergenic
1142220042 16:88849813-88849835 CTGAAGCTGATGAGGAAGAAAGG + Intronic
1142233634 16:88911238-88911260 CTGTGGGTGATGACGATGGACGG + Intronic
1142321554 16:89386453-89386475 CTGTCCCTGGTGAGAAAAGAGGG - Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143066944 17:4257217-4257239 GTGGGGCTGGTGAGGACTGATGG - Intronic
1143106681 17:4533731-4533753 CTGTGGTTGCTGCGGATGGAGGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143688036 17:8534987-8535009 GTGCGGGTGGTGAGGAAGGACGG + Intronic
1143818247 17:9537386-9537408 CTGTGACTGGAGAAGAATGAGGG - Intronic
1143986942 17:10923000-10923022 CAGTAGCTGGTGAGGAAGTGGGG - Intergenic
1144597667 17:16584589-16584611 CTGTGACGGCTGAGGAGGGAGGG + Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145749322 17:27343924-27343946 CTCTGGCTCGGAAGGAAGGAAGG + Intergenic
1145761325 17:27426769-27426791 CTGTGGCTGGGGAGGCAGCCTGG - Intergenic
1145909027 17:28532137-28532159 CGGGAGCTGGTGGGGAAGGAAGG - Intronic
1145919447 17:28599364-28599386 CTGCGGCTGGAGAGGACTGAGGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146910200 17:36643528-36643550 CTGTGGGTGGAGAGGATGGTGGG + Intergenic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147262732 17:39218017-39218039 CTGTGGGTGGTGGGGAGGGAGGG + Exonic
1147307482 17:39573874-39573896 CTGTGGCTGGCCAGGCAGGGCGG + Intergenic
1147319936 17:39640013-39640035 CTGGGTCTGGTGAGGAAGACTGG - Intronic
1147383976 17:40071154-40071176 CTGTGGCTGGCAAGGAGGGCTGG + Intronic
1147759635 17:42789074-42789096 CTGTGGCTGTAGGTGAAGGATGG + Intronic
1148615678 17:48998168-48998190 CCGTCGGTGGGGAGGAAGGATGG - Intronic
1148761401 17:50003587-50003609 CTGTGTCCGGTGAGGCAAGAGGG + Intergenic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1148835872 17:50465459-50465481 CTGGGGCTGGGGAAGAAGGTGGG + Intronic
1149084741 17:52701918-52701940 GTATGGCTGGGGAGGTAGGAAGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149397586 17:56260723-56260745 CTGTGCCTGGTGAGGCTGGCAGG - Intronic
1149497096 17:57125881-57125903 CAATTGCTGGTGAGGTAGGAAGG + Intergenic
1149503111 17:57170235-57170257 CAGGGGCTGGTGAGGAGGGAAGG + Intergenic
1149659351 17:58326279-58326301 CTGAGGGTGGTGAGGAAAGGAGG - Exonic
1150007670 17:61479683-61479705 CTGGGGTTGGGGAGGAGGGAAGG + Intronic
1150291903 17:63987208-63987230 CTGTTGCTGATGAGGCAGAATGG + Intergenic
1150525443 17:65917694-65917716 CTGTGCCTCGTGAGAAAAGAAGG - Intronic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151678516 17:75612115-75612137 CAAAGGCTGGGGAGGAAGGAGGG - Intergenic
1152009227 17:77700675-77700697 CTGGGGCTGGGGAGGCAGGGAGG + Intergenic
1152010361 17:77709363-77709385 CTGTGGGAGATGAGGAGGGAGGG + Intergenic
1152045608 17:77933167-77933189 TTTTGGGTGGTGAGAAAGGAAGG - Intergenic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152226851 17:79096752-79096774 CGGTGTCTGCTGAGGAGGGAGGG + Intronic
1152896956 17:82917482-82917504 CTGTGGCTGTTTCTGAAGGACGG + Intronic
1153331634 18:3880286-3880308 GGGAGGCTGGTGTGGAAGGATGG - Intronic
1153429343 18:4999080-4999102 CTGCTGCTGGGGATGAAGGAGGG - Intergenic
1153466110 18:5389525-5389547 CTGTGGCTGGAGAAGTAGGTGGG + Intergenic
1153516642 18:5909703-5909725 CTGAAGCTGGGGAGGAAGCAAGG + Intergenic
1153691673 18:7600683-7600705 CTGCAGCTAGTGAGGAAGCAGGG - Intronic
1153942667 18:9991199-9991221 AAGAGGCTGGGGAGGAAGGAAGG - Intergenic
1154357035 18:13629427-13629449 CTGTGCCTGGGAAGGAAGTAAGG + Intronic
1155510266 18:26569429-26569451 CTGTGAGTTGTCAGGAAGGAAGG - Intronic
1156778470 18:40821947-40821969 CTGGAGCTGGGGAGGCAGGATGG + Intergenic
1157307717 18:46529127-46529149 CTGGGCCTGGAGAGGAGGGAAGG + Intronic
1157863211 18:51160093-51160115 CTGTGGCCAGTGAGAAAGCACGG + Intergenic
1159588169 18:70302050-70302072 CTGCAGCTGGTGAGGAAGGTGGG + Intronic
1159814283 18:73053707-73053729 GAGTCGCTGATGAGGAAGGATGG + Intergenic
1160239026 18:77109401-77109423 GTGTGGAAGGTGAGGAAAGAGGG + Intronic
1160582895 18:79897783-79897805 CTGTTGCTGGGGAGGAAGAGGGG - Intronic
1160622669 18:80181624-80181646 CAGTCGCTGATGAGGGAGGATGG - Intronic
1160872044 19:1282122-1282144 ATGTGAATGGAGAGGAAGGATGG + Intergenic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161647860 19:5465422-5465444 GTGTGGCTGGTGTGGACGGCAGG + Intergenic
1162059009 19:8083480-8083502 CAGTGGCCGGTGTGGAAGGGAGG - Intronic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1162927103 19:13936179-13936201 CTGTGGCTTTTGAGTAGGGATGG - Intronic
1163264110 19:16207996-16208018 CTGTGGCGGTTGGGGAGGGAGGG - Intronic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163528230 19:17834460-17834482 GTGTGTCTGGTGAGGTTGGAGGG - Intronic
1163536733 19:17881210-17881232 ATTTGTCTGGGGAGGAAGGAAGG - Intronic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163648127 19:18501831-18501853 CTGCGGGTGGGCAGGAAGGAGGG + Intronic
1163667262 19:18609126-18609148 CAGTGGCTGGGGCGGAATGAGGG - Intronic
1164145946 19:22512684-22512706 CTGGGCCAGGTGTGGAAGGAGGG + Intronic
1164461720 19:28454721-28454743 CTGTGCCTGGTGAGCAGTGATGG - Intergenic
1165230525 19:34383705-34383727 CTGGGGCAGGTGAGGCAGGCAGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165781164 19:38434943-38434965 CTGGGGCTGGTAGTGAAGGATGG + Intronic
1165846200 19:38819290-38819312 CTGTGGCTGTTGAAGAGGGAGGG - Intronic
1166366845 19:42282126-42282148 CTGGGGCTGCATAGGAAGGAGGG + Intronic
1166466558 19:43037200-43037222 CTGTGCATGGGAAGGAAGGAAGG - Intronic
1166854777 19:45778076-45778098 CTGGGGCTGCTGATGAGGGATGG - Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167108375 19:47444509-47444531 CTGGGGCCGGCGAGGAGGGAGGG + Intronic
1167324087 19:48813343-48813365 CAGTGGCTGGGGAGAAAAGAGGG + Exonic
1167327832 19:48836276-48836298 CTGTGGAGTGTGAGAAAGGAAGG - Intronic
1167419726 19:49395705-49395727 CTGTGGCTGGTGAGGACTGAGGG + Intronic
1167466637 19:49653733-49653755 CTGGGGCAGGTGAGACAGGATGG + Intronic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1168353019 19:55687282-55687304 CTGTGGCTGGGGAGGAGGATGGG + Intronic
1168429995 19:56271112-56271134 ATGAGGCTGCTAAGGAAGGATGG + Intronic
1168446000 19:56414398-56414420 CCCTGGATGGTGAAGAAGGAGGG + Exonic
925443758 2:3910137-3910159 CTGTGCCTGGAGAGGAAGGTTGG - Intergenic
925652329 2:6104332-6104354 CTGTGGCTGCTGTGGGGGGATGG + Intergenic
926287928 2:11505392-11505414 CAGTGGCTGGAGAGACAGGAAGG - Intergenic
926291066 2:11530894-11530916 CTGAGGCTGGCCAGGAAGGGTGG + Intergenic
926312779 2:11686466-11686488 TGGAGGCTGGTGGGGAAGGACGG + Intronic
926367163 2:12144000-12144022 ATGTGGCTGGAGAAGAAGGCAGG + Intergenic
926689751 2:15725150-15725172 TTGTGGCTGTAAAGGAAGGAGGG + Intronic
926726712 2:16004371-16004393 CTGTGTGTGGTGAGGATGGGAGG + Intergenic
927003996 2:18828468-18828490 CTGAGGCTTGATAGGAAGGAGGG - Intergenic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927499708 2:23574531-23574553 CAGTGGCTGGCGTGGAGGGAAGG + Intronic
927710471 2:25322657-25322679 CTGGGGTTGGTGAGGAAGTGGGG - Intronic
928096975 2:28410695-28410717 CTCTGGCTGGGGATGAAAGAAGG + Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928330363 2:30353156-30353178 TTGGGACTGGGGAGGAAGGAGGG + Intergenic
928460332 2:31466511-31466533 ATGGGGGTGGTGAGGAAGGCTGG - Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928871039 2:35979891-35979913 TTGTGGCTGGTGTGGATTGAGGG - Intergenic
929807813 2:45162496-45162518 CAGAGGCTGGTGATGCAGGAAGG + Intergenic
930023044 2:47012859-47012881 CTGTGGCTGATCAGGAGGAAGGG + Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
931682559 2:64763791-64763813 CTGTGGGTGGTGAAGAAGTTGGG - Intergenic
931979252 2:67677010-67677032 CATTGGGTGGTGAGGAAAGAGGG - Intergenic
932143090 2:69296831-69296853 CTGTGGCTGGTGTGGAAAGAGGG - Intergenic
932310184 2:70733552-70733574 CATTGCCTGTTGAGGAAGGAAGG + Intronic
932478672 2:72024999-72025021 GCGTGGCTGGAGAGGCAGGAAGG - Intergenic
932623251 2:73279154-73279176 CTGTGGCAGGTAAGAAAGGGAGG + Intronic
932774946 2:74522766-74522788 CTGGAGCTGGTGAGGAAACAGGG + Exonic
932780738 2:74556924-74556946 CTGGGGCTTGGGAGCAAGGAGGG - Exonic
932840063 2:75073627-75073649 CTGAGGCTGGTCTGGCAGGAGGG + Intronic
933530956 2:83511176-83511198 CTGCTGCTGATGATGAAGGAGGG + Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933726736 2:85431290-85431312 ATGGGGCGGGTGGGGAAGGAGGG - Intronic
933774870 2:85765807-85765829 GCCTGGCTGGTGAGGAAGGAGGG + Intronic
934041269 2:88129428-88129450 CTGTGGCTTGAGGAGAAGGAAGG - Intergenic
934527728 2:95062026-95062048 CCGTGGCTGGGGAGGAAGGAAGG - Intergenic
934923678 2:98366609-98366631 CCCTGCCTGGTGAGGAGGGATGG + Intronic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
935827196 2:106963654-106963676 CTGTGGCCAGTGAGAAAGAAAGG - Intergenic
936497124 2:113032087-113032109 CTCTGGGTTGAGAGGAAGGAGGG + Intronic
938163261 2:129005227-129005249 CTGTAGCTGCTGTGGAAGGTGGG + Intergenic
938271878 2:129979784-129979806 CTGAGCCGGGTGCGGAAGGAGGG + Exonic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939736866 2:145857969-145857991 GTGTGGCTGAAGAGGAATGAGGG - Intergenic
939804445 2:146755030-146755052 CTGTGGCTTGTGATGAATGAAGG - Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
941136396 2:161722896-161722918 CCCTGCCTGGTGAGGAGGGATGG + Intronic
941698920 2:168582850-168582872 CTGTGGGTGCTTGGGAAGGATGG - Intronic
942462340 2:176177139-176177161 GTGATGCTGGAGAGGAAGGACGG + Intergenic
942715118 2:178882903-178882925 CATTAGCTGGTGAGGAAGAAAGG + Intronic
946522955 2:220486423-220486445 GAGTGGCTAGTGAGGTAGGAGGG + Intergenic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
947822731 2:233083275-233083297 CTGGGAGTGGTGGGGAAGGAGGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948044090 2:234929242-234929264 CAGAGGCTGGTCAGGAAGGTGGG + Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
948465900 2:238151477-238151499 CTGAGGCTGCTGGGGAAGGCAGG + Exonic
948480585 2:238247737-238247759 GTGTAGCTGGAGAGGAGGGAAGG + Intronic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1168931701 20:1629612-1629634 ACGTGGCAGGGGAGGAAGGAAGG + Exonic
1169023569 20:2348628-2348650 GTGAGACTGGAGAGGAAGGAAGG - Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169748238 20:8964676-8964698 CTGTGGCAAGGAAGGAAGGAAGG + Intronic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1172015365 20:31869921-31869943 CTGGGGCTGGGGAGGCAGAAAGG + Intronic
1172115562 20:32571656-32571678 TGGTGGCTGGGGAGGAAGCACGG - Intronic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172821011 20:37734398-37734420 CAGAAGCTGGTGAGGAGGGAAGG - Intronic
1172845847 20:37929672-37929694 CTGTTGCAGGTGAGAGAGGATGG + Intronic
1173034045 20:39391354-39391376 CTGTGGCTGGAGTGGATCGAAGG + Intergenic
1173860144 20:46277890-46277912 CGGTAGCTGGAGAGGAAGGCAGG + Intronic
1174005283 20:47405980-47406002 CTCAGGATGCTGAGGAAGGAGGG - Intergenic
1174044567 20:47724378-47724400 CTGTGGCTATTGAGGAAGACTGG + Intronic
1174102821 20:48140095-48140117 CTGTGGCTGGGGAGGAGGTCTGG - Intergenic
1174199684 20:48798529-48798551 CTGGTGCTGGTGTGGAGGGAGGG - Intronic
1174352740 20:49980091-49980113 GAGTGGCTGGTGAGGAGGGGAGG - Intergenic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1175378866 20:58548880-58548902 CTGGGGCTGGTCTGGTAGGAAGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175451638 20:59073702-59073724 CTTAGGCTGGGGAGGAAGCATGG + Intergenic
1176023991 20:62976574-62976596 CAGAGGCTGGGGTGGAAGGATGG + Intergenic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176206985 20:63894620-63894642 CAGTGGTTGGACAGGAAGGAAGG + Intergenic
1176248233 20:64107558-64107580 CTGATGCTGGTGAGGGAGGGAGG + Intergenic
1176625091 21:9086391-9086413 CTGTGCCAGGTGAGCAAGGTAGG - Intergenic
1176723673 21:10413094-10413116 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1176796418 21:13373733-13373755 GTGTGGCTGGAGCGGTAGGAAGG + Intergenic
1177167373 21:17617772-17617794 GTGTGGCGGGTGATGAAGGTCGG + Intergenic
1177278042 21:18941681-18941703 CTGTGGCTTGTTAGGAACCAGGG + Intergenic
1177651948 21:23968881-23968903 CTGTAGCTGCTGAGGAAGGGAGG + Intergenic
1178121598 21:29475176-29475198 CTGGGGCTGATGAGGAATGAGGG + Intronic
1178350950 21:31872994-31873016 CTGTGGCGCGCGGGGAAGGAGGG + Intergenic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178790278 21:35693356-35693378 CGCTGGCTGCTGAGAAAGGAAGG - Intronic
1179152355 21:38819817-38819839 CTGTGGCTCGAAAGGAAGCAAGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179576216 21:42310067-42310089 CTGGGGCTCGCGAGGAAGGCAGG + Intergenic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179708496 21:43195894-43195916 CGGTGGGAGGTGGGGAAGGAAGG + Intergenic
1180304829 22:11065871-11065893 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1180599548 22:17007400-17007422 GAGTGGCGGGTGAGGAGGGAAGG + Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183284661 22:36954265-36954287 TTGGGGCAGGTGAGGAAGGATGG - Intergenic
1183600137 22:38835331-38835353 CTGTCCCTGGAGAGGAAGGCAGG - Intronic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1183668016 22:39256308-39256330 CTGTGGCTGGGGAGGATTGTGGG - Intergenic
1184096096 22:42317370-42317392 ATGTGTGTGGTGGGGAAGGAGGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184811123 22:46832875-46832897 CTGTGGAATGTGAGGAAGAAGGG + Intronic
1184817102 22:46880763-46880785 CCATGGCAGGTGGGGAAGGAGGG + Intronic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
1185086155 22:48742159-48742181 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086170 22:48742202-48742224 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086185 22:48742245-48742267 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185088165 22:48751975-48751997 CTGTGGCTGGTGAGGCTGGTGGG + Intronic
950083245 3:10238758-10238780 CTGTGGCTGCTGTGGAAGAGCGG + Exonic
950167854 3:10815186-10815208 TTGTGGCTAGAGAGGAAGGGAGG - Intergenic
950764134 3:15260742-15260764 GTGTGGCTGGAGAGGCAGGGTGG + Intronic
950847367 3:16027825-16027847 TTGTGTCTGCTGAGGAATGAGGG - Intergenic
950918152 3:16666151-16666173 CTTTGCCTGGTGAGTAAGAAAGG - Intronic
953027687 3:39154118-39154140 CTGTGGCTGGAGAGGAATCTGGG + Intronic
953443529 3:42941519-42941541 CTGAGGCAGGTAGGGAAGGAGGG - Intronic
953974895 3:47375149-47375171 ATGGGGCTAGTGAGGAGGGAAGG - Intergenic
954115969 3:48466984-48467006 CTGTGGCTGGCGCCGCAGGAAGG - Exonic
954532107 3:51330050-51330072 CTGTGGTGGGTGAGGATGGTGGG - Intronic
954680218 3:52341770-52341792 CTGAGTCAAGTGAGGAAGGATGG + Intronic
954805458 3:53217395-53217417 CAGTGGTTGGTGAGGAAGCTGGG + Intergenic
955344485 3:58150950-58150972 CCGTGACTCGTTAGGAAGGATGG - Intronic
955950660 3:64239287-64239309 CTGGGGCAGCTGTGGAAGGAAGG + Intronic
955989633 3:64612580-64612602 CTGTGGCTGGTCAGGGTGAAGGG + Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
958448897 3:94249055-94249077 CTGTGGCTGGATAGAAACGAGGG + Intergenic
958775992 3:98483430-98483452 CTGTGGCAGGTAAGGAGGGGTGG - Intergenic
960620138 3:119629336-119629358 CAGTGGCTGGTGAGGAGACAGGG - Intronic
961055722 3:123787328-123787350 GTGTGGCTGGTGCGGAATGAGGG + Intronic
961112461 3:124296689-124296711 GTGTGGCTGGGGAGGCAGGTGGG - Intronic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961951023 3:130749185-130749207 ATGAGTGTGGTGAGGAAGGAGGG - Intergenic
962076558 3:132088438-132088460 TTCTGGCAGGTGACGAAGGATGG - Intronic
963732308 3:148986106-148986128 GCGTGGCTGGTGAGGAAGTGGGG + Intergenic
964283511 3:155092834-155092856 CTGAGGCTGGAGATGAAGCAGGG + Intronic
964672164 3:159238631-159238653 CAGAGGTTGCTGAGGAAGGAGGG + Intronic
964899303 3:161638579-161638601 ATGTGGCTGGAGAGGGATGATGG + Intergenic
965345011 3:167537681-167537703 TTGTGCCTGGTGGGGAAGGGAGG + Intronic
965860301 3:173141033-173141055 CAGTGGCTGGGTGGGAAGGAAGG - Intronic
965980173 3:174680965-174680987 TTGAGGCTGGGGAGGAAGGGTGG - Intronic
966709209 3:182952744-182952766 TTGTGTATGATGAGGAAGGAAGG - Intronic
966910576 3:184557417-184557439 CTGGGGCTGGTGAGAAAACAGGG + Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968666173 4:1823457-1823479 AAGGGGCTGGTGAGGAGGGATGG + Intronic
968695626 4:2024760-2024782 CTGTGGTTGGTTAGGAAGTCTGG + Intronic
968702714 4:2064449-2064471 CTGTGCTTGGTGAGCAAGGCTGG - Exonic
968768046 4:2484873-2484895 CTGTGTCTGGTGAGAACAGATGG - Intronic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
968846166 4:3042763-3042785 CTGTGGCTGGCAAGGAAGTCAGG - Intergenic
969030122 4:4205146-4205168 CAGGGGATGGTGAGGATGGAAGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969690790 4:8703067-8703089 CTGTGTCTCGGGAGGAAGAAAGG - Intergenic
970263076 4:14250182-14250204 CCAGGGCTGGTGAGGTAGGAAGG + Intergenic
970858235 4:20673002-20673024 GTGTGGCTGTTGAAGAAGCAAGG - Intergenic
970914994 4:21322027-21322049 CAGAGGCAGGGGAGGAAGGAAGG + Intronic
971425094 4:26508087-26508109 CTTGGGATGCTGAGGAAGGAGGG - Intergenic
972973104 4:44601855-44601877 GTGTGGGTGGTGGGGAGGGATGG - Intergenic
973535469 4:51877463-51877485 TTCTGGCTGGTGAGGTAGAAGGG + Intronic
973792994 4:54395334-54395356 CTGCTACTGGTCAGGAAGGAGGG - Intergenic
973832415 4:54775022-54775044 ATGATGCTGGTGAGGTAGGAAGG + Intergenic
974683554 4:65195259-65195281 CTGAGGGTGCTGAGGAAGAAGGG + Intergenic
974908184 4:68082731-68082753 CTGTGGCTGGTGCTGCAGCAGGG + Intronic
975846873 4:78534358-78534380 CTGTGGAGGGTGGGGAAGGGAGG + Intronic
976142436 4:82006478-82006500 CTGTGGTGAGTGAGAAAGGAAGG - Intronic
976205316 4:82618587-82618609 ATGTGGGTGATGAGGAAGGCTGG + Intergenic
976463490 4:85340993-85341015 TTGTGTCTGGTAAGGTAGGATGG - Intergenic
976865811 4:89724933-89724955 TGGGCGCTGGTGAGGAAGGAAGG - Exonic
976951946 4:90844432-90844454 ATGTGGCTGGAGTGGAATGAGGG - Intronic
977689475 4:99889667-99889689 ATGTGGCTGGAGAGGAAGGATGG + Intronic
977836369 4:101650013-101650035 CTGAGCCAGGTGAGGAAGAAAGG - Intronic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
981128458 4:141132856-141132878 CCGGGGCTGGGGAGGAGGGACGG - Intronic
981140035 4:141257415-141257437 CAGTGTCTAGTGAGTAAGGAAGG - Intergenic
982253660 4:153432165-153432187 CTGGGGGTGCTGAGGAAGGAGGG + Intergenic
982399994 4:154955282-154955304 CTGTGCCTGGGGTGGAAGCACGG + Intergenic
982960320 4:161827624-161827646 CTGTGGCTGCTGTGGAAGATGGG + Intronic
983059868 4:163146705-163146727 GGGAGGCTGGCGAGGAAGGACGG + Intronic
983774905 4:171594764-171594786 CCCTGCCTGGTGAGGAGGGATGG + Intergenic
984025810 4:174541982-174542004 CTCTGGCTGCTGTGGAAGAATGG + Intergenic
984351802 4:178603689-178603711 GTGTGTCTGGTTGGGAAGGAGGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984810403 4:183791214-183791236 CAGTGGATGGTGACGAAGCATGG + Intergenic
984936031 4:184890063-184890085 GGCTGGCTGGTGAGGAAGAAGGG - Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986051396 5:4093816-4093838 ACGGGGATGGTGAGGAAGGATGG - Intergenic
986325548 5:6670596-6670618 CAGTGGGTGCTGAGGACGGATGG + Intergenic
986687882 5:10289920-10289942 CCGACGCTGGAGAGGAAGGAAGG + Intronic
986709365 5:10477480-10477502 CTGTTGATGGACAGGAAGGAAGG + Intergenic
986712670 5:10499300-10499322 CTGAGGCTGGCGAGTCAGGATGG + Intergenic
987910851 5:24142655-24142677 CTGGGCCTGGTGAGGCAGAAAGG - Intronic
988531701 5:32033512-32033534 CTCTTGCTGTTGAGCAAGGAAGG - Intronic
989163603 5:38414034-38414056 CTGTGGCCTGTTAGGAAGCAGGG - Intronic
989315964 5:40078905-40078927 CTGGGGTTGATGAGGAGGGAGGG + Intergenic
989510182 5:42277595-42277617 ATATGGCTGCTTAGGAAGGAAGG - Intergenic
990013285 5:51026265-51026287 CTTTTGCAAGTGAGGAAGGAAGG + Intergenic
990407129 5:55502990-55503012 CTGAGGCTGGTGAGAGAGGTAGG - Intronic
990847611 5:60161355-60161377 TTCTGGATGGTGAGGAAGAAGGG - Intronic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992944719 5:81798751-81798773 ATGTTGCTGGGGAGGAAGGAGGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
995685348 5:114766324-114766346 CCCTGTCTGGTGAGGAAGGATGG + Intergenic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
996590966 5:125147427-125147449 CTGTGGCCGGGGAGGAAGGGAGG - Intergenic
997700180 5:135892052-135892074 CTGTGGCTGGAGCTGCAGGAGGG - Intergenic
997958952 5:138303985-138304007 CTGTATCTGGTGAGAAAAGAAGG + Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998211920 5:140206086-140206108 ATGTGCCTGGTGAGGAAGGGAGG - Intronic
998385526 5:141755017-141755039 CTGTGGGGGCTGGGGAAGGAGGG + Intergenic
998717746 5:144905528-144905550 CTGTGTCTGGGAAGTAAGGATGG + Intergenic
999256666 5:150213394-150213416 CTGTGGCGGGGAAGGAGGGAAGG + Intronic
999385141 5:151148804-151148826 GTGTGGCTGGTGTGGTAGCAGGG + Intronic
999443062 5:151617369-151617391 CTGGGCCTGTGGAGGAAGGAAGG + Intergenic
999716572 5:154365741-154365763 CTGAGTGTGGTGTGGAAGGAAGG - Intronic
999938581 5:156515940-156515962 CCCTGCCTGGTGAGGAGGGATGG - Intronic
1000229634 5:159303416-159303438 CTGCGGCTGTTCAGGAAGCACGG + Intergenic
1000719884 5:164693368-164693390 CCCTGGCTGATGAGGAGGGATGG - Intergenic
1001552168 5:172610988-172611010 CTGTGCTTGGGGAGAAAGGATGG + Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001964908 5:175903291-175903313 TTGAGCCTGGTGAGGAAAGATGG + Intergenic
1001980947 5:176036776-176036798 GTGTGGCTGGAGCGGTAGGAAGG + Intergenic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002236512 5:177807289-177807311 GTGTGGCTGGAGCGGTAGGAAGG - Intergenic
1002252047 5:177935897-177935919 TTGAGCCTGGTGAGGAAAGATGG - Intergenic
1002306350 5:178286190-178286212 CTGGGCCTGGTGAGGGATGAGGG - Intronic
1002341652 5:178520195-178520217 GGATGGCTGGTAAGGAAGGAGGG + Intronic
1002845283 6:939851-939873 CTGGGGCTGGGGAGGAAGGCTGG - Intergenic
1002932982 6:1647015-1647037 CCCTGGCTAGGGAGGAAGGATGG + Intronic
1003115666 6:3282313-3282335 CTGTGGCTGATGCAGAAGGTAGG + Intronic
1003162096 6:3644802-3644824 CTGTGACTTCTGAAGAAGGAAGG + Intergenic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1003954005 6:11145486-11145508 CTGTGAGGGGTAAGGAAGGAAGG + Intergenic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1004449413 6:15730972-15730994 CTGTGTCTGGAAAGGCAGGAGGG - Intergenic
1004882396 6:20022033-20022055 CTCTGGTTGGTGGGGCAGGAGGG + Intergenic
1005005650 6:21284853-21284875 GTGTGCCTGGTGGGGAAAGAAGG - Intergenic
1005025703 6:21461007-21461029 CTCTTGCTCGTGGGGAAGGAGGG + Intergenic
1005755585 6:28923019-28923041 CTGTAGCTGGCGAGGAAGCCAGG - Intronic
1006115818 6:31775740-31775762 CTGTGGCTGGAGAGAAGTGAGGG - Intronic
1006425818 6:33962330-33962352 CTGTGTCTGAGAAGGAAGGAAGG - Intergenic
1006444376 6:34070590-34070612 GTGGGGCTGCTGAGGCAGGAGGG + Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006964026 6:37963643-37963665 CTGTTGCTGGTGAAGCAGGATGG - Intronic
1007346408 6:41232871-41232893 GAGTGGCTGGTGAGCAAGTAAGG - Intronic
1007609687 6:43141552-43141574 CTGTGGGTGGTCAGGAGCGATGG + Intronic
1007734631 6:43972906-43972928 CTCTAGCAGGTGAGGAATGAAGG + Intergenic
1007786748 6:44284630-44284652 CTCTGGCTTGTGAGGCTGGATGG - Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1009644293 6:66377814-66377836 CTGTGGCAGGTGGGGAGGGTGGG + Intergenic
1010502362 6:76616204-76616226 GTGTGGCTGGAGAGGAATGATGG - Intergenic
1010561257 6:77353456-77353478 CTGTTGCTGGGGATGAAGGAGGG + Intergenic
1011459722 6:87590283-87590305 CCCTGGCTGGAGAGGAGGGAGGG + Intronic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1015544267 6:134346001-134346023 CTGTGGCTGGAGAGGAGTGTAGG + Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1017790469 6:157793678-157793700 CTGGGGTTGCTGAGGCAGGATGG - Intronic
1017798267 6:157867414-157867436 CTGTGGCTGTTTTGGAAGAAAGG - Intronic
1017903405 6:158737828-158737850 CTGTGTCTGCTGAGCAGGGACGG - Intronic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1018200958 6:161395308-161395330 GTGTGGCTGTTCAGGAAGAATGG - Intronic
1018250683 6:161866899-161866921 CTCTGGCTGAAGAGGATGGATGG + Intronic
1018838143 6:167500526-167500548 CAGTTGCTGGTGATGAGGGAGGG - Intergenic
1018859821 6:167703623-167703645 ATGTGGCCAGTGAGGAAGGCAGG + Intergenic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019193271 6:170266695-170266717 CTGTGGCTGGGCAGCACGGAAGG - Intergenic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019709459 7:2511669-2511691 CTGGGGCTGGGGTGGAGGGAGGG - Intergenic
1019918437 7:4148226-4148248 CAGTGGCGGGTGTGGGAGGAGGG - Intronic
1020139865 7:5606352-5606374 CTGGGGCTGGACGGGAAGGACGG - Exonic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1021186984 7:17576025-17576047 CCCTGCCTGGTGAGGAGGGATGG - Intergenic
1022349702 7:29556487-29556509 CTGTGGCTGGAGGGGAAGAGAGG + Intergenic
1022392775 7:29958024-29958046 CTCGGAATGGTGAGGAAGGAAGG + Intronic
1022535088 7:31093564-31093586 CTGATGCTGGGGAGGAAGGTTGG + Intronic
1022905296 7:34849871-34849893 CTGGGAATGGTGGGGAAGGAAGG - Intronic
1023201078 7:37697576-37697598 CTGTGGTGGTTTAGGAAGGAGGG + Intronic
1024127721 7:46317730-46317752 CTGTGGCTGGAAACGTAGGATGG + Intergenic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1025212573 7:57028687-57028709 CTGGGGGTGGGCAGGAAGGAGGG - Intergenic
1025259113 7:57405258-57405280 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1025609739 7:63067896-63067918 CTCTGGCTGGAGAGAAAAGAGGG + Intergenic
1025659380 7:63548140-63548162 CTGGGGGTGGGCAGGAAGGAGGG + Intergenic
1025710236 7:63901301-63901323 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1025967231 7:66285443-66285465 ATGTGGCTCCTGAGGTAGGAGGG + Intronic
1026324014 7:69293277-69293299 CTGTCTCTGGAAAGGAAGGAAGG - Intergenic
1026661899 7:72309818-72309840 CTGGACCTGGTGATGAAGGAAGG - Intronic
1026824463 7:73572830-73572852 CTGTGGCAGGTGGGCAAGGAGGG - Exonic
1027221737 7:76218438-76218460 CTGGGGCTGCTGAGCAAGAATGG - Intronic
1028452864 7:91005215-91005237 CTGAGGCTGGTGAGCCAGCAGGG + Intronic
1028665520 7:93338990-93339012 ATGTGGAAGGTGAGGAAGAAGGG + Intronic
1029068067 7:97872269-97872291 CTGGGGCTGCTCCGGAAGGAAGG - Intronic
1029402600 7:100355281-100355303 ACGTGGCTGGTGAGGAAAGGAGG + Intronic
1029630698 7:101748303-101748325 CGGAGGCTGGAGAGAAAGGATGG + Intergenic
1031979787 7:128117049-128117071 TTGTGGCTGGCGAGGCCGGACGG - Intergenic
1032085912 7:128883923-128883945 CTGGGACTGGTGAGGAAGGGCGG + Intronic
1032697085 7:134346497-134346519 CTGTGGCAGGTGATGAATTAGGG - Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033061136 7:138109362-138109384 ATGTGGGTGGAGAGAAAGGAGGG - Intronic
1033988569 7:147256217-147256239 CTATGGTTGGTGGGGAAGAAAGG + Intronic
1034270005 7:149798808-149798830 CAGGGGCTGGAGAGGAAGGAGGG + Intergenic
1034270114 7:149799671-149799693 CAGGGGCTGGAGAGAAAGGAGGG - Intergenic
1035317371 7:158004985-158005007 CTGAGGCTTGTGAGGAAAGGGGG - Intronic
1036089770 8:5652982-5653004 ATGTGGGTGGTGAGGAATGATGG + Intergenic
1036567541 8:9950338-9950360 CTGAGTCTGGTGAGGATGGAGGG + Intergenic
1036692999 8:10956476-10956498 CTGAGGCTGGAGAGGATGAAGGG + Intronic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038247932 8:25876552-25876574 CCGTGGCTGGTGAGCATGAAGGG - Intronic
1038509285 8:28115854-28115876 CTGAGGGTGGTAGGGAAGGAGGG - Intronic
1038966539 8:32579405-32579427 CTGAGGCTGGAGAGAAAGAAGGG + Intronic
1039019101 8:33185677-33185699 CTGTGGCTGCTGTGAACGGAAGG + Intergenic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1040531154 8:48267409-48267431 CTCTGCCTAGGGAGGAAGGAAGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042200774 8:66277959-66277981 CTGTGGCTGGGACGGAAGGGAGG + Intergenic
1042325669 8:67525190-67525212 CTGTGGTTGGAAAGAAAGGATGG - Intronic
1042542654 8:69922472-69922494 CTGAGGCTGGTGTGGGAGGCAGG - Intergenic
1042781082 8:72491853-72491875 GTGTGGATCGAGAGGAAGGAAGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044251605 8:90009179-90009201 GTGTGGCTGGAGAAGAAGGAAGG - Intronic
1044618865 8:94169493-94169515 GTGTGTCTGGTGAGGAATGGAGG + Intronic
1044896129 8:96893396-96893418 CCGTGGCTGGTGAGGAAAATAGG + Intronic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1044948591 8:97414328-97414350 ATGTGGCTGGGTAGGAAAGATGG + Intergenic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1045459365 8:102412616-102412638 CTAGGGGAGGTGAGGAAGGAGGG + Exonic
1045752663 8:105504040-105504062 CTGTGGCTTGTCAAGAAGTAAGG + Intronic
1045797445 8:106062457-106062479 GTGTGGCTGGGGAGGATTGAGGG + Intergenic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1045948813 8:107828718-107828740 CTTGTGCTGGTGAGGAAGGGAGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047975586 8:130127155-130127177 GTGTGGCTGAGTAGGAAGGAAGG + Intronic
1048376336 8:133825847-133825869 CAGAGACTGGAGAGGAAGGAAGG - Intergenic
1048438994 8:134445903-134445925 CTGTGGCTAATGATGAGGGAAGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048893127 8:138965515-138965537 CTGTGACTGGATTGGAAGGATGG + Intergenic
1049155615 8:141064828-141064850 CTGTGGCTGGTAATTAAGCATGG - Intergenic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049403272 8:142440350-142440372 CTGTGGCAGGTGGGGAGGCAGGG + Intergenic
1049421594 8:142518992-142519014 ATGTGGCTGGTGGGGGAGGGTGG + Intronic
1049440295 8:142606490-142606512 CTGTGGCTGTTGGGTGAGGAAGG - Intergenic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1049674976 8:143885324-143885346 CTGTGGCTGGGAGGGAAGGCTGG - Intergenic
1050931340 9:11330886-11330908 ATGTGTCTGGTGGGGATGGAGGG - Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1053056076 9:34993757-34993779 CATTGGCTGATGAGGAAGGTTGG + Intronic
1053595145 9:39553113-39553135 TTGTGGCTGGTGAATAAAGAAGG + Intergenic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1054571114 9:66811861-66811883 TTGTGGCTGGTGAATAAAGAAGG - Intergenic
1055773948 9:79747807-79747829 CTAGGGATGGGGAGGAAGGAGGG - Intergenic
1056108514 9:83371762-83371784 GTCTGGTTAGTGAGGAAGGATGG - Intronic
1058506348 9:105669896-105669918 CTGGAGTTGGGGAGGAAGGAGGG + Intergenic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1059155283 9:111983841-111983863 CTGTGGCTGCTCAGAAGGGAAGG - Intergenic
1059224503 9:112659458-112659480 CTGTGGGTGCTGAGTAAGGCAGG + Exonic
1059449449 9:114361176-114361198 ATGTGGCTGGAGAGGCAGGCAGG - Intronic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1059636459 9:116175980-116176002 CTGTGGCTGGTACAGAAAGATGG + Intronic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1061792950 9:133068154-133068176 CAGTGGCTGCTGAGGCAGGCGGG - Intronic
1061795556 9:133083938-133083960 CAGTGGCTGCTGAGGCAGGCGGG - Intronic
1061897401 9:133655641-133655663 ATCTGGCTGGTGGGGAAGAAAGG - Intronic
1061959906 9:133982562-133982584 CTCTGGCTGGCGGGGCAGGAGGG + Intronic
1062044883 9:134420361-134420383 CTGTGGCTGCTGCTGATGGAAGG + Intronic
1062144673 9:134982453-134982475 CTGTGGCTGGAGAGTCAGGCTGG + Intergenic
1062227896 9:135464121-135464143 CTGTGGCTGGTGGGAAAGGGAGG - Intergenic
1062479018 9:136742963-136742985 CTGTGTCGGGAGAGGAGGGAGGG + Intronic
1062542637 9:137048428-137048450 CTGAGGGTGGGGTGGAAGGATGG + Exonic
1203748264 Un_GL000218v1:56847-56869 CTGTGCCAGGTGAGCAAGGTAGG - Intergenic
1203561457 Un_KI270744v1:61161-61183 CTGTGCCAGGTGAGCAAGGTAGG + Intergenic
1185483948 X:468266-468288 CTGGGGCAGGGCAGGAAGGAGGG - Intergenic
1186035393 X:5416670-5416692 TTGTCACTGGTGAGGAATGAAGG - Intergenic
1186952045 X:14637307-14637329 CTGTGGATGGTGGGGAACTATGG + Intronic
1187498142 X:19814143-19814165 GTGTGGCAGGAGAGGAAGGAGGG - Intronic
1189518826 X:41744178-41744200 CTATGGCTGGTGACTAAGGAGGG + Intronic
1189946082 X:46180309-46180331 CTGTGGCTGCTGTGGGAGTAGGG + Intergenic
1189981442 X:46514736-46514758 GTGTAGTGGGTGAGGAAGGAAGG - Intronic
1190252309 X:48736580-48736602 GTTTGGCTGGTGAGGTAGGTAGG - Intergenic
1190339961 X:49288381-49288403 CAGTGGCCAGTGAGGAAGAAGGG - Intronic
1190539276 X:51460368-51460390 CAGTATCTGGTGAGGTAGGAGGG - Intergenic
1190929196 X:54933957-54933979 GTGTGGCTGGTGATGGGGGAGGG - Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1194491800 X:94560267-94560289 CAATGGCTGGTGAGGATGGGAGG - Intergenic
1194584599 X:95717163-95717185 CAGTGACTGATAAGGAAGGAAGG + Intergenic
1194978309 X:100414868-100414890 CAGTGGCGGGGGAGGCAGGAAGG - Intergenic
1195275224 X:103275090-103275112 CTATGGCTGGTGAGGATAGAGGG - Intronic
1195296751 X:103486091-103486113 CTGTGGCTGAATAGGAATGAAGG + Intergenic
1195328197 X:103775146-103775168 CTGTGGCTGGCGAGCAGGGCTGG + Intronic
1195519790 X:105817978-105818000 CTGTGCCAGGTGAGGAAGAATGG + Intergenic
1195761752 X:108254025-108254047 CTGTACCTTGTGAGGCAGGAAGG - Intronic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198244819 X:134820064-134820086 CTGTGGCTGCTGAAGATGGTAGG - Intronic
1198347238 X:135770641-135770663 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198349144 X:135787903-135787925 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198352956 X:135822440-135822462 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198354865 X:135839696-135839718 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198639722 X:138743370-138743392 CAGGGGTTGGTGGGGAAGGAGGG + Intronic
1199266216 X:145830283-145830305 CTGTGTCTGGTGAGGAGAGTGGG - Intergenic
1200053473 X:153446614-153446636 CAGTGGCTGCTGGGGAAGGAAGG + Intronic
1200094332 X:153650249-153650271 GTGGGGGTGGTGAAGAAGGAGGG - Exonic
1201161614 Y:11171821-11171843 CTGTGCCAGGTGAGCAAGGTAGG - Intergenic
1201226467 Y:11823562-11823584 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic