ID: 1114673625

View in Genome Browser
Species Human (GRCh38)
Location 14:24427852-24427874
Sequence GAGTGTCTCTGCGCCTGCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 375}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114673625_1114673630 -4 Left 1114673625 14:24427852-24427874 CCGACGCAGGCGCAGAGACACTC 0: 1
1: 0
2: 0
3: 16
4: 375
Right 1114673630 14:24427871-24427893 ACTCGGTCCCCAGGGTCCAAGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1114673625_1114673629 -5 Left 1114673625 14:24427852-24427874 CCGACGCAGGCGCAGAGACACTC 0: 1
1: 0
2: 0
3: 16
4: 375
Right 1114673629 14:24427870-24427892 CACTCGGTCCCCAGGGTCCAAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1114673625_1114673635 13 Left 1114673625 14:24427852-24427874 CCGACGCAGGCGCAGAGACACTC 0: 1
1: 0
2: 0
3: 16
4: 375
Right 1114673635 14:24427888-24427910 CAAGGGCAGTAGCACAGAGCTGG 0: 1
1: 0
2: 2
3: 30
4: 274
1114673625_1114673638 28 Left 1114673625 14:24427852-24427874 CCGACGCAGGCGCAGAGACACTC 0: 1
1: 0
2: 0
3: 16
4: 375
Right 1114673638 14:24427903-24427925 AGAGCTGGTGGCTGCCTCCCGGG 0: 1
1: 0
2: 4
3: 36
4: 377
1114673625_1114673637 27 Left 1114673625 14:24427852-24427874 CCGACGCAGGCGCAGAGACACTC 0: 1
1: 0
2: 0
3: 16
4: 375
Right 1114673637 14:24427902-24427924 CAGAGCTGGTGGCTGCCTCCCGG 0: 1
1: 0
2: 3
3: 55
4: 387
1114673625_1114673636 16 Left 1114673625 14:24427852-24427874 CCGACGCAGGCGCAGAGACACTC 0: 1
1: 0
2: 0
3: 16
4: 375
Right 1114673636 14:24427891-24427913 GGGCAGTAGCACAGAGCTGGTGG 0: 1
1: 0
2: 2
3: 25
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114673625 Original CRISPR GAGTGTCTCTGCGCCTGCGT CGG (reversed) Exonic
900000201 1:10640-10662 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000206 1:10669-10691 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000211 1:10698-10720 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000216 1:10727-10749 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000221 1:10756-10778 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000225 1:10785-10807 GCATGTGTCTGCGCCTGCGCCGG - Intergenic
900000237 1:10857-10879 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
900000251 1:10933-10955 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
900019903 1:181149-181171 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019908 1:181178-181200 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019913 1:181207-181229 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019918 1:181236-181258 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019925 1:181265-181287 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019930 1:181294-181316 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019934 1:181323-181345 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
900402376 1:2477866-2477888 GAGTGCCTGTGCCCCTGCCTGGG - Intronic
902607273 1:17575706-17575728 GAGTGTCTCTGTGGCAGCGGAGG + Intronic
902966142 1:20004486-20004508 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
905893383 1:41530689-41530711 GAGTGGCTGTGGGCCTGTGTGGG - Intronic
906403803 1:45525399-45525421 GAGTCTCTCTGAGCCTACGCTGG - Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
913424091 1:118707332-118707354 GTGTGTCTCTGCACCTGAGATGG - Intergenic
914408822 1:147404623-147404645 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
914683254 1:149955922-149955944 GTGTGTCTCTGCACCTGAGATGG + Intronic
914983310 1:152435102-152435124 GTGTGTCTCTGCACGTGAGTTGG + Intergenic
915260431 1:154673103-154673125 TAGTGTTTCTGCTGCTGCGTTGG + Intergenic
916939377 1:169663544-169663566 TAGTGTTTCTGCTGCTGCGTCGG + Intronic
917445950 1:175105982-175106004 TAGTGTTTCTGCTGCTGCGTCGG - Intronic
918750302 1:188262116-188262138 TAGTGTTTCTGCTGCTGCGTTGG - Intergenic
919206153 1:194423602-194423624 TAGTGTTTCTGCTGCTGCGTTGG + Intergenic
919464453 1:197912633-197912655 GCGTGTGTGTGCGCCTTCGTTGG + Intronic
919558524 1:199091869-199091891 AAGTGTTTCTGCTGCTGCGTCGG + Intergenic
922231712 1:223692788-223692810 GAGAGGCTCTGCACCAGCGTGGG + Intergenic
924957675 1:248944946-248944968 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957680 1:248944975-248944997 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957685 1:248945004-248945026 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1063621362 10:7651791-7651813 GTGTGTCTCAGAGCCTGCATTGG - Intronic
1064603696 10:17017231-17017253 TAGTGTTTCTGCTGCTGCGTTGG - Intronic
1066060254 10:31717564-31717586 GTGTGTCTCTGCACGTGAGTTGG + Intergenic
1066077302 10:31892364-31892386 GTGTGTCTCTGCACGTGAGTTGG - Intronic
1069137467 10:64783279-64783301 TAGTGTTTCTGCTGCTGCGTCGG - Intergenic
1071263062 10:83938586-83938608 GAGTCACTCTGCGCCTGTCTGGG - Intergenic
1071509648 10:86253558-86253580 GTGTGTCTCTGGGCCTGGGAGGG - Intronic
1072874276 10:99154856-99154878 GTGTGTCTCTGCACGTGAGTTGG - Intronic
1072888131 10:99298112-99298134 CAGTGTCTCTGCTACTGGGTAGG + Intergenic
1074742773 10:116500887-116500909 TAGTGTTTCTGCTGCTGCGTTGG - Intergenic
1075082640 10:119394091-119394113 GTGTGTGTCTGCGTCTGTGTGGG + Intronic
1076816475 10:132917457-132917479 GGGAGTCTCTGAGCCTGCGTGGG + Intronic
1076919894 10:133446044-133446066 GAGCTTTTCTGGGCCTGCGTCGG + Intergenic
1076963519 10:133786460-133786482 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963526 10:133786489-133786511 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963533 10:133786518-133786540 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1079811784 11:25005690-25005712 TAGTGTTTCTGCTGCTGCGTCGG - Intronic
1085022517 11:73218338-73218360 GTGGGTCTCTGCGGCTGCGGCGG + Exonic
1088473475 11:110211095-110211117 GTGTGTCTCTGCACATGAGTTGG - Intronic
1091372954 11:135076179-135076201 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372959 11:135076208-135076230 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372964 11:135076237-135076259 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372969 11:135076266-135076288 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372974 11:135076295-135076317 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372979 11:135076324-135076346 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372984 11:135076353-135076375 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091373280 12:10736-10758 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373285 12:10765-10787 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373290 12:10794-10816 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373295 12:10823-10845 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373300 12:10852-10874 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373305 12:10881-10903 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373310 12:10910-10932 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373314 12:10939-10961 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
1091373336 12:11062-11084 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
1091943389 12:4510993-4511015 GTGTGTCTCTGCACCTGAGATGG - Intronic
1092011822 12:5120303-5120325 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1093568935 12:20643376-20643398 GGGTGTCTTTGCTCCTGGGTTGG + Intronic
1094320086 12:29173820-29173842 TAGTGTTTCTGCTGCTGCGTAGG - Intronic
1094338237 12:29384231-29384253 TAGTGTTTCTGCTGCTGCGTTGG - Intergenic
1094482124 12:30892922-30892944 GTGTGTCTCTGCACATGAGTTGG + Intergenic
1095976662 12:47944953-47944975 GTGTGTGTGTGCGCCTGTGTGGG - Intergenic
1096922239 12:55100147-55100169 GTGTGTCTCTGCACGTGCGATGG + Intergenic
1099414867 12:82372935-82372957 TAGTGTTTCTGCTGCTGCGTCGG - Intronic
1101507275 12:105359097-105359119 TAGTTTCTCTTCCCCTGCGTCGG + Intronic
1103598971 12:122042083-122042105 GAGTGACTCTGTGCCTGAGAAGG + Intronic
1105008870 12:132740976-132740998 GTGTGTCTCTTTGCCTGTGTTGG - Intronic
1105317067 13:19275103-19275125 GTGTGTCTCTGCACCTGAGATGG - Intergenic
1105762351 13:23526364-23526386 TAGTGTTTCTGCTGCTGCGTCGG + Intergenic
1106162563 13:27214216-27214238 TAGTGTTTCTGCTGCTGCGTTGG + Intergenic
1112693035 13:101917092-101917114 CAGGGTCTCTGCGCGTCCGTCGG + Intronic
1113757072 13:112819953-112819975 GAGTGCCTCTGCGGATGCCTTGG + Intronic
1113767148 13:112888670-112888692 GAGTGTCTGTGTGCCTGCAGCGG + Intergenic
1113989949 13:114353281-114353303 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989954 13:114353310-114353332 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989959 13:114353339-114353361 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989964 13:114353368-114353390 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989969 13:114353397-114353419 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1114031261 14:18583128-18583150 GGGCCTCTCTGCGCCTGCGCCGG - Intergenic
1114432687 14:22675918-22675940 GTGTGTCTCTGCACATGAGTTGG + Intergenic
1114433194 14:22680067-22680089 GTGTGTCTCTGCACATGAGTTGG - Intergenic
1114673625 14:24427852-24427874 GAGTGTCTCTGCGCCTGCGTCGG - Exonic
1115285589 14:31710416-31710438 TAGTGTTTCTGCTGCTGCGTTGG - Intronic
1116618912 14:47173901-47173923 GTGTGTCTCTGCGCATGAGCTGG - Intronic
1118307714 14:64669277-64669299 GAGTGTCTATGAGCTTGCCTTGG + Intergenic
1118896676 14:69951053-69951075 GCATGTCTCTGTGCCTGGGTTGG + Intronic
1122113171 14:99515466-99515488 GGGTGTCTCTGGGCCTGCAGTGG - Intronic
1122773622 14:104107800-104107822 GTGTGCCTGTGCCCCTGCGTGGG + Intronic
1122861335 14:104583797-104583819 GAGTGTATCTGCGTATGTGTGGG - Intronic
1123439908 15:20282672-20282694 GCGCCTCTCTGCGCCTGCGCTGG + Intergenic
1125332536 15:38596407-38596429 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1130576816 15:85100405-85100427 GCGGGTCTCTGAGCCTGCGAGGG + Intronic
1132453256 15:101980012-101980034 ATGTGTCTCTGCGCCTGCGCCGG + Intergenic
1132453270 15:101980088-101980110 ATGTGTCTCTGCGCCTGCGCCGG + Intergenic
1132453283 15:101980161-101980183 GCATGTGTCTGCGCCTGCGCCGG + Intergenic
1132453287 15:101980190-101980212 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132453292 15:101980219-101980241 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132453636 16:10612-10634 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
1132797644 16:1733207-1733229 GAGTGCCTCTGAGGCTGTGTCGG + Intronic
1136417529 16:30112997-30113019 GAGTGTATCTGCCCCTGCCCAGG - Intronic
1138720583 16:59074491-59074513 GTGTGTCTCTGCACATGCGACGG - Intergenic
1139631515 16:68234554-68234576 GAGTTTCTCTGCCCCTCGGTTGG - Intronic
1140979141 16:80089957-80089979 GTGTGTCTCTGCACGTGCGATGG + Intergenic
1142410607 16:89914309-89914331 GTGTGTGTGTGCGCCTGTGTGGG + Intronic
1143016137 17:3892280-3892302 GAGTGTGCCTGTGTCTGCGTGGG - Intronic
1143191430 17:5042862-5042884 GACTGTCTCTGGGCCTGGCTTGG + Intronic
1143794128 17:9322545-9322567 GAGGGTCTCTGTGCCTGCAGAGG - Intronic
1149248002 17:54734285-54734307 GAGTGTTTCTGAGACTGTGTAGG + Intergenic
1153437922 18:5086972-5086994 TAGTGTTTCTGCTGCTGCGTCGG + Intergenic
1159533204 18:69682003-69682025 CAGTGTCTCTGCTCATGAGTGGG + Intronic
1159645566 18:70914656-70914678 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1159818476 18:73108401-73108423 GAATGTCTCTGGGCCTGTTTTGG + Intergenic
1160490430 18:79333131-79333153 CAGGGTCTCTGCGCGTGCCTGGG + Intronic
1161079502 19:2303485-2303507 GGGTGTGTCTGCGCTTGCGGGGG + Intronic
1161319202 19:3633251-3633273 AAGTGTCTCAGGGCCTGTGTTGG - Intronic
1161908373 19:7174558-7174580 GAGTGTCTCTGTGTGGGCGTCGG - Intronic
1163547417 19:17948349-17948371 GGGTGGCTCTGCGCCTGCGCGGG + Intergenic
1163631050 19:18418031-18418053 GTGTGTCTCCGCGCGTGGGTGGG - Intergenic
1164071259 19:21770418-21770440 GAGTCTCTCTGCGCCTACTCTGG - Intergenic
1164351295 19:27346748-27346770 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1165288038 19:34859577-34859599 GTGTGTCTCTGCACCTGAGATGG - Intergenic
1167033555 19:46979238-46979260 CAGTGCCACTGGGCCTGCGTGGG + Intronic
1168351038 19:55675550-55675572 TTGTGTCTCTGCTCCTGTGTCGG + Intronic
1168728654 19:58606914-58606936 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1202647692 1_KI270706v1_random:157312-157334 GGGCCTCTCTGCGCCTGCGCCGG - Intergenic
924958320 2:10854-10876 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958325 2:10883-10905 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958330 2:10912-10934 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958335 2:10941-10963 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958340 2:10970-10992 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958345 2:10999-11021 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958350 2:11028-11050 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958355 2:11057-11079 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958360 2:11086-11108 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958365 2:11115-11137 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
925034834 2:677108-677130 GAGTGGCTCGGGGCCGGCGTCGG - Intronic
927610559 2:24535338-24535360 GTGTGTCTCTGCACGTGAGTGGG + Intronic
930038379 2:47102092-47102114 TAGTGTTTCTGCTGCTGCGTCGG + Intronic
934617274 2:95780705-95780727 GTGTGTCTCTGCACGTGCGATGG - Intergenic
934643619 2:96043854-96043876 GTGTGTCTCTGCACGTGCGATGG + Intergenic
934693584 2:96381217-96381239 GTGTGTCTCTGCACCTGAGATGG - Intergenic
934866991 2:97822694-97822716 TAGTGTTTCTGCTGCTGCGTTGG + Intronic
935191461 2:100781891-100781913 GAGTGTCTCACAGCCTGGGTAGG + Intergenic
938498051 2:131813623-131813645 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
940253218 2:151702755-151702777 GTGTGTCTCTGCACGTGAGTTGG + Intronic
941075387 2:161001391-161001413 GTGTGTCTCTGCACGTGCGATGG + Intergenic
946558431 2:220885510-220885532 GATTTTCTCTGCTCCTGCATAGG - Intergenic
948419461 2:237847345-237847367 GTGTGTCTCTGCACGTGAGTTGG + Intergenic
948481355 2:238252444-238252466 CAGTGTCCCTACGCCTGCGGAGG + Intronic
948994235 2:241570596-241570618 GAGTGTCTGAGCGCCTGTGGGGG + Intronic
948994277 2:241570749-241570771 GAGTGTCTGAGCGCCTGTGGGGG + Intronic
948994319 2:241570902-241570924 GAGTGTCTGAGCGCCTGTGGGGG + Intronic
948994339 2:241570979-241571001 GAGTGTCTGAGCGCCTGTGGGGG + Intronic
949088913 2:242182551-242182573 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088920 2:242182580-242182602 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088927 2:242182609-242182631 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088934 2:242182638-242182660 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088941 2:242182667-242182689 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088948 2:242182696-242182718 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088955 2:242182725-242182747 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088962 2:242182754-242182776 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1169539208 20:6581229-6581251 GAGTGTGTGTACACCTGCGTGGG - Intergenic
1171892983 20:30733355-30733377 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
1172690234 20:36784831-36784853 GAGTGTCTCCCAGCCTGCCTCGG - Exonic
1173204149 20:40979543-40979565 CAGTATCTCTGCACCTGCTTGGG - Intergenic
1176604160 21:8815419-8815441 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1176706230 21:10121407-10121429 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1179347060 21:40568464-40568486 GAGTGTTTCTGTGCCTGCAGTGG - Intronic
1179369066 21:40787163-40787185 GGGTGTTTCTGCCCCTGAGTAGG - Intronic
1180264137 21:46698833-46698855 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264142 21:46698862-46698884 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264147 21:46698891-46698913 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264152 21:46698920-46698942 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264158 21:46698949-46698971 GCGCCTCTCTGCGCCTGCGGCGG + Intergenic
1180264162 21:46698978-46699000 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264167 21:46699007-46699029 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264172 21:46699036-46699058 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264177 21:46699065-46699087 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264182 21:46699094-46699116 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264187 21:46699123-46699145 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264192 21:46699152-46699174 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264197 21:46699181-46699203 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264202 21:46699210-46699232 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264207 21:46699239-46699261 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346445 22:11706997-11707019 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346451 22:11707026-11707048 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354214 22:11825150-11825172 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354220 22:11825179-11825201 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1184717079 22:46288423-46288445 GAGTGTCTGTGGGCCAGCGGTGG + Exonic
1185077196 22:48689853-48689875 AAGTGTCTCTGAGCCTGGCTGGG + Intronic
1185430375 22:50807214-50807236 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1185430380 22:50807243-50807265 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949089489 3:11012-11034 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089494 3:11041-11063 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089499 3:11070-11092 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089504 3:11099-11121 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089509 3:11128-11150 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089514 3:11157-11179 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089519 3:11186-11208 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089524 3:11215-11237 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089529 3:11244-11266 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089534 3:11273-11295 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089539 3:11302-11324 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089544 3:11331-11353 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089549 3:11360-11382 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089554 3:11389-11411 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089564 3:11447-11469 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089569 3:11476-11498 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089574 3:11505-11527 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089579 3:11534-11556 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089584 3:11563-11585 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089589 3:11592-11614 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089594 3:11621-11643 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089599 3:11650-11672 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089604 3:11679-11701 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089609 3:11708-11730 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089616 3:11754-11776 GTGTCTCTCTGCGCCTGCGCCGG - Intergenic
951006013 3:17616776-17616798 GTGTGTCTCTGCACCTGAGATGG + Intronic
951020341 3:17775911-17775933 TAGTGTTTCTGCTGCTGCGTCGG + Intronic
951827414 3:26883602-26883624 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
952420301 3:33124510-33124532 GAGTGTCTCGCAGCCTGCGAGGG + Exonic
952680423 3:36084974-36084996 GTGTGTCTCTGCACGTGCGATGG - Intergenic
953999089 3:47542178-47542200 GAGTCTCTCTGAGTCTGCCTGGG + Intergenic
954363205 3:50133281-50133303 GACTCTCCCTGCTCCTGCGTGGG - Intergenic
954488636 3:50879382-50879404 GTGTGTCTCTGCACCTGAGATGG - Intronic
954686855 3:52375817-52375839 GAGTGTCTCTGAGCCTTTATGGG + Intronic
959958749 3:112271759-112271781 GAGTGTCTCTAGGCCTCAGTTGG + Intronic
960318565 3:116207292-116207314 GTGTGTCTCTGCACATGAGTTGG + Intronic
962844733 3:139264201-139264223 GATTGTCTGAGGGCCTGCGTGGG + Intronic
964957813 3:162382711-162382733 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
966870140 3:184285025-184285047 GAGTGACTCTGAGCCTGTGGTGG + Exonic
967948299 3:194821188-194821210 CAGTGTCTCTGCGTGTGAGTGGG + Intergenic
968619181 4:1596064-1596086 GAGGGTCCCTGCTCCTGCGCTGG + Intergenic
969525220 4:7700826-7700848 GAGTGTGTCTCCACCTGTGTGGG + Intronic
971521948 4:27564691-27564713 GAGTCCCTCTGCGCCTACTTGGG + Intergenic
973387063 4:49519752-49519774 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
973683186 4:53342211-53342233 GTGTGTCTCTGCACGTGAGTTGG - Intronic
975157474 4:71088292-71088314 GTGTGTCTCTGCACCTGAGGTGG + Intergenic
975165879 4:71177432-71177454 GTGTGTCTCTGCACCTGAGATGG - Intergenic
975255873 4:72234758-72234780 GTGTGTCTCTGCGCCTGAGATGG + Intergenic
976592741 4:86865236-86865258 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
977516003 4:98021905-98021927 GTGTGTCTCTGCACCTGAGATGG + Intronic
977835061 4:101636667-101636689 TAGTGTTTCTGCTGCTGCGTCGG - Intronic
981530731 4:145751744-145751766 GAGCATCTCTGGGCCTGCCTGGG - Intronic
983447373 4:167870691-167870713 GAGTGTCTGTGCACCTGTCTGGG - Intergenic
984430196 4:179638770-179638792 GTGTGTCTCTGCGCGTGAGATGG - Intergenic
984917304 4:184736049-184736071 TAGTGTTTCTGCTGCTGCGTCGG + Intergenic
985466742 4:190203758-190203780 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466747 4:190203787-190203809 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466752 4:190203816-190203838 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466759 4:190203845-190203867 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466766 4:190203874-190203896 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466773 4:190203903-190203925 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466780 4:190203932-190203954 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466787 4:190203961-190203983 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985467607 5:12473-12495 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467612 5:12502-12524 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467617 5:12531-12553 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467622 5:12560-12582 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467627 5:12589-12611 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467632 5:12618-12640 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467637 5:12647-12669 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467642 5:12676-12698 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467647 5:12705-12727 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467652 5:12734-12756 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467657 5:12763-12785 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467662 5:12792-12814 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467667 5:12821-12843 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467671 5:12845-12867 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467675 5:12869-12891 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467679 5:12893-12915 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467683 5:12917-12939 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
991275777 5:64844612-64844634 GAGAGTCTCTCTGCCTGGGTGGG - Intronic
992700740 5:79339624-79339646 GTGTGTCTCTGCGCATGAGATGG + Intergenic
993261323 5:85661484-85661506 GTGTGTCTCTGCGCGTGAGATGG + Intergenic
993619300 5:90148992-90149014 GTGTGTCTCTGCACCTGAGATGG - Intergenic
993627240 5:90240488-90240510 GTGTGTCTCTGCACCTGAGATGG - Intergenic
993742464 5:91557623-91557645 GTGTGTCTCTGCACCTGAGATGG - Intergenic
996348502 5:122513506-122513528 GTGTGTCTCTGCACCTGAGACGG + Intergenic
996680229 5:126222905-126222927 TAGTGTTTCTGCTGCTGCGTCGG + Intergenic
997470664 5:134115245-134115267 GAGCGTCCCTGCCCCGGCGTCGG + Intronic
997581551 5:135020308-135020330 GTGTGTGTGTGCGCCTGTGTGGG + Intergenic
998914907 5:147002677-147002699 TAGTGTTTCTGCTGCTGCGTCGG + Intronic
999521365 5:152354072-152354094 GAGTGTGTCTGAACCTGCATGGG + Intergenic
1000085071 5:157881549-157881571 TAGTGTTTCTGCTGCTGCGTTGG + Intergenic
1000686351 5:164254647-164254669 GAGTCTCTCTGCGCCTGGCCAGG + Intergenic
1001296448 5:170502539-170502561 GTGTGTCTCTCCACCTTCGTGGG + Intronic
1002533575 5:179863853-179863875 GTGTGTGTCTCCGCCTGCTTTGG + Exonic
1003819923 6:9884554-9884576 GTGTGTCTCTGCACCTGAGATGG - Intronic
1006221630 6:32496555-32496577 TAGTGTTTCTGCTGCTGCGTTGG + Intergenic
1006509076 6:34512107-34512129 GGGTGTCCCTGTGCCAGCGTGGG + Intronic
1010204742 6:73312579-73312601 GTGTGTCTCTGCCCCTGAGATGG + Intergenic
1011296707 6:85834430-85834452 GAGTGTCTCTCCTCCTGCAAAGG - Intergenic
1012849690 6:104431770-104431792 GAGTGTCTCTGAGCCTACTCTGG + Intergenic
1013258453 6:108413019-108413041 GTGTGTCTCTGCACCTGAGATGG - Intronic
1016183866 6:141177690-141177712 TAGTGTTTCTGCTGCTGCGTTGG + Intergenic
1018983369 6:168616930-168616952 CTGTGTCCCTGCACCTGCGTGGG - Intronic
1021374305 7:19887851-19887873 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1022952693 7:35353641-35353663 ATCTGTCTCTGCTCCTGCGTGGG + Intergenic
1023355862 7:39366589-39366611 TAGTGTCTCTGGGCCTGGGTAGG - Intronic
1024498020 7:50070129-50070151 GAGTGTCTCTCATCCTGGGTAGG + Intronic
1024718823 7:52111430-52111452 GAGTCTCTCTGAGCCTACGCTGG - Intergenic
1025591101 7:62861026-62861048 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
1025980612 7:66402250-66402272 CAGTTTCTCTGCACCTGCCTGGG - Intronic
1026295390 7:69047610-69047632 TTGTGTGTCTGTGCCTGCGTGGG - Intergenic
1027205501 7:76094619-76094641 CAGTTTCTCTGCACCTGCCTGGG - Intergenic
1027921915 7:84405148-84405170 GTGTGTCTCTGCACCTGAGATGG - Intronic
1028585509 7:92447689-92447711 CCGTGTCTCTGCGCCCGCGGGGG + Exonic
1033537329 7:142324010-142324032 GAGTGTTTCTGCCTCTGCATGGG + Intergenic
1033539033 7:142339007-142339029 GAGTGTCCCTGTGTCTGCTTGGG + Intergenic
1033544966 7:142391579-142391601 GAGTGTCTCTGCTGCTGCACGGG + Intergenic
1033759407 7:144423313-144423335 TAGTGTTTCTGCTGCTGCGTCGG - Intergenic
1035495064 7:159317499-159317521 GAGTCTCTCTGAGCCTGCTGTGG + Intergenic
1039767836 8:40649178-40649200 GTGTGTCTCTGCACGTGAGTTGG - Intronic
1040803219 8:51366429-51366451 GAGTCTCTCTGAGCCTGCTCTGG + Intronic
1041156016 8:54987240-54987262 GTGTGTCTCTGCACATGAGTTGG - Intergenic
1041665704 8:60442842-60442864 GTGTGTCTCTGCACATGAGTTGG + Intergenic
1043949096 8:86288043-86288065 GAGTGGCTCTGCGTCTGGCTTGG + Intronic
1049883037 9:10977-10999 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049883042 9:11006-11028 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049883046 9:11035-11057 ATGTGTCTCTGCGCCTGCGCCGG - Intergenic
1050165602 9:2761732-2761754 GAGTCTCTCTGAGCCTGCTCTGG + Intronic
1051221073 9:14849028-14849050 AAGTGTCTCTGCACTTGCTTAGG + Intronic
1051879193 9:21823016-21823038 GTGTGTCTCTGCACGTGAGTTGG + Intronic
1052725989 9:32228920-32228942 GTGTGTCTCTGCGCATGAGATGG + Intergenic
1053003126 9:34588813-34588835 TAGTGTATCTCCGCGTGCGTGGG - Intronic
1053088406 9:35249243-35249265 GTGTGTCTCTGCACATGCGACGG + Intronic
1053167370 9:35854066-35854088 GAGGGACTCTGTGCCTGCATAGG - Exonic
1053643515 9:40108524-40108546 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1053762636 9:41356966-41356988 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1054324143 9:63704714-63704736 CTGTCTCTCTGCGCCTGCGCCGG - Intergenic
1054324372 9:63705752-63705774 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054350970 9:64016569-64016591 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351018 9:64016801-64016823 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351024 9:64016830-64016852 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351030 9:64016859-64016881 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351036 9:64016888-64016910 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351042 9:64016917-64016939 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351048 9:64016946-64016968 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054541237 9:66268080-66268102 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1055533450 9:77211556-77211578 GAGTCTCTCTGAGCCTGCTCTGG - Intronic
1056090038 9:83196312-83196334 GAGTGGCTCTGCACCTGGGATGG + Intergenic
1057517578 9:95735105-95735127 GGGTGTCTCTGAACCTGGGTTGG + Intergenic
1058409533 9:104716146-104716168 GTGTGTCTCTGCACCTGAGATGG - Intergenic
1061263037 9:129490398-129490420 CAGTGTGTCTGTGCCTGTGTGGG - Intergenic
1202791266 9_KI270719v1_random:91496-91518 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1189934770 X:46056243-46056265 GTGTGTCTCTGCACATGAGTTGG + Intergenic
1189998040 X:46657476-46657498 GTGTGTCTCTGCACGTGAGTTGG - Intronic
1191048063 X:56160777-56160799 GTGTGTCTCTGCGCGTGAGATGG + Intergenic
1191049981 X:56181351-56181373 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1191082308 X:56525718-56525740 GTGTGTCTCTGCACGTGCGATGG - Intergenic
1191585480 X:62821835-62821857 GTGTGTCTCTGCACCTGAGATGG - Intergenic
1192704342 X:73513162-73513184 GTGTGTCTCTGCCCATGAGTTGG - Intergenic
1193376615 X:80768834-80768856 GTGTGTCTCTGCACCTGAGTTGG - Intronic
1194246032 X:91512860-91512882 GTGTGTCTCTGCACCTGAGATGG - Intergenic
1195340375 X:103901006-103901028 GAGTGTCTCTGCACGTGAGATGG + Intergenic
1196474558 X:116067784-116067806 GTGTGTCTCTGCACGTGAGTTGG + Intergenic
1196574214 X:117299953-117299975 GAGTCTGTGTGCTCCTGCGTTGG + Intergenic
1196621648 X:117831326-117831348 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1196625998 X:117877888-117877910 GTGTGTCTCTGCACCTGAGATGG + Intergenic
1197478206 X:126949040-126949062 GTGTGTCTCTGTGCCTGAGATGG - Intergenic
1200402755 X:156029106-156029128 ATGTGTCTCTGCGCCTGCGCCGG + Intergenic
1200402759 X:156029135-156029157 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402764 X:156029164-156029186 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402769 X:156029193-156029215 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402774 X:156029222-156029244 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402779 X:156029251-156029273 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402784 X:156029280-156029302 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402789 X:156029309-156029331 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402794 X:156029338-156029360 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200588891 Y:5044999-5045021 GTGTGTCTCTGCACCTGAGATGG + Intronic
1201249468 Y:12041616-12041638 GTGTGTCTCTGCACGTGAGTTGG - Intergenic
1201429526 Y:13890477-13890499 TAGTGTTTCTGCTGCTGCGTCGG + Intergenic
1201487407 Y:14507847-14507869 TAGTGTTTCTGCTGCTGCGTCGG + Intergenic
1201524386 Y:14915264-14915286 GGGTGTCTCTGCACGTGAGTTGG + Intergenic
1201600742 Y:15726208-15726230 GTGTGTCTCTGCACCTGAGATGG + Intergenic