ID: 1114674197

View in Genome Browser
Species Human (GRCh38)
Location 14:24430099-24430121
Sequence ACCGCCTCCGCCGCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 404}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114674197_1114674199 2 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674199 14:24430124-24430146 GCGCGCCCCTCCACCGCGCCCGG 0: 1
1: 0
2: 2
3: 42
4: 282
1114674197_1114674205 9 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674205 14:24430131-24430153 CCTCCACCGCGCCCGGGAGCGGG 0: 1
1: 0
2: 1
3: 23
4: 204
1114674197_1114674206 10 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674206 14:24430132-24430154 CTCCACCGCGCCCGGGAGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 157
1114674197_1114674200 3 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674200 14:24430125-24430147 CGCGCCCCTCCACCGCGCCCGGG 0: 1
1: 0
2: 2
3: 27
4: 355
1114674197_1114674210 16 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674210 14:24430138-24430160 CGCGCCCGGGAGCGGGGAGCGGG 0: 1
1: 0
2: 3
3: 49
4: 458
1114674197_1114674216 29 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674216 14:24430151-24430173 GGGGAGCGGGGGCCGCGGTGCGG 0: 1
1: 0
2: 9
3: 143
4: 1071
1114674197_1114674209 15 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674209 14:24430137-24430159 CCGCGCCCGGGAGCGGGGAGCGG 0: 1
1: 0
2: 1
3: 118
4: 546
1114674197_1114674215 24 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674215 14:24430146-24430168 GGAGCGGGGAGCGGGGGCCGCGG 0: 1
1: 1
2: 28
3: 246
4: 1802
1114674197_1114674211 17 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674211 14:24430139-24430161 GCGCCCGGGAGCGGGGAGCGGGG 0: 1
1: 0
2: 9
3: 83
4: 601
1114674197_1114674203 8 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674203 14:24430130-24430152 CCCTCCACCGCGCCCGGGAGCGG 0: 1
1: 0
2: 1
3: 15
4: 147
1114674197_1114674212 18 Left 1114674197 14:24430099-24430121 CCGGCGCGGGCGGCGGAGGCGGT 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1114674212 14:24430140-24430162 CGCCCGGGAGCGGGGAGCGGGGG 0: 1
1: 0
2: 6
3: 109
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114674197 Original CRISPR ACCGCCTCCGCCGCCCGCGC CGG (reversed) Intronic