ID: 1114674729

View in Genome Browser
Species Human (GRCh38)
Location 14:24432339-24432361
Sequence GGGGGTTCCGGTGCAGGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 382}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114674729_1114674743 14 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674743 14:24432376-24432398 ACCGGGGTGACTGCGGAGACCGG 0: 1
1: 0
2: 1
3: 13
4: 127
1114674729_1114674745 15 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674745 14:24432377-24432399 CCGGGGTGACTGCGGAGACCGGG 0: 1
1: 0
2: 1
3: 15
4: 178
1114674729_1114674739 -3 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674739 14:24432359-24432381 CCCATGGCACTGTGGAGACCGGG 0: 1
1: 0
2: 2
3: 19
4: 225
1114674729_1114674749 26 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674749 14:24432388-24432410 GCGGAGACCGGGGAGACGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 160
1114674729_1114674748 25 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674748 14:24432387-24432409 TGCGGAGACCGGGGAGACGTGGG 0: 1
1: 0
2: 0
3: 2
4: 113
1114674729_1114674746 16 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674746 14:24432378-24432400 CGGGGTGACTGCGGAGACCGGGG 0: 1
1: 0
2: 0
3: 12
4: 144
1114674729_1114674741 -2 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674741 14:24432360-24432382 CCATGGCACTGTGGAGACCGGGG 0: 1
1: 0
2: 1
3: 13
4: 157
1114674729_1114674747 24 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674747 14:24432386-24432408 CTGCGGAGACCGGGGAGACGTGG 0: 1
1: 0
2: 1
3: 19
4: 174
1114674729_1114674742 7 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674742 14:24432369-24432391 TGTGGAGACCGGGGTGACTGCGG 0: 1
1: 0
2: 2
3: 15
4: 228
1114674729_1114674737 -4 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674737 14:24432358-24432380 CCCCATGGCACTGTGGAGACCGG 0: 1
1: 0
2: 2
3: 24
4: 238
1114674729_1114674750 27 Left 1114674729 14:24432339-24432361 CCTCCACCTGCACCGGAACCCCC 0: 1
1: 0
2: 1
3: 28
4: 382
Right 1114674750 14:24432389-24432411 CGGAGACCGGGGAGACGTGGGGG 0: 1
1: 0
2: 1
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114674729 Original CRISPR GGGGGTTCCGGTGCAGGTGG AGG (reversed) Exonic