ID: 1114680225

View in Genome Browser
Species Human (GRCh38)
Location 14:24478128-24478150
Sequence CTCAAGTTAGGGAAGTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114680218_1114680225 19 Left 1114680218 14:24478086-24478108 CCCAGACATCAACAAATACTCTT No data
Right 1114680225 14:24478128-24478150 CTCAAGTTAGGGAAGTGATCTGG No data
1114680219_1114680225 18 Left 1114680219 14:24478087-24478109 CCAGACATCAACAAATACTCTTC No data
Right 1114680225 14:24478128-24478150 CTCAAGTTAGGGAAGTGATCTGG No data
1114680222_1114680225 -9 Left 1114680222 14:24478114-24478136 CCATGAGTATGGGTCTCAAGTTA No data
Right 1114680225 14:24478128-24478150 CTCAAGTTAGGGAAGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114680225 Original CRISPR CTCAAGTTAGGGAAGTGATC TGG Intergenic
No off target data available for this crispr