ID: 1114680225 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:24478128-24478150 |
| Sequence | CTCAAGTTAGGGAAGTGATC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114680218_1114680225 | 19 | Left | 1114680218 | 14:24478086-24478108 | CCCAGACATCAACAAATACTCTT | No data | ||
| Right | 1114680225 | 14:24478128-24478150 | CTCAAGTTAGGGAAGTGATCTGG | No data | ||||
| 1114680219_1114680225 | 18 | Left | 1114680219 | 14:24478087-24478109 | CCAGACATCAACAAATACTCTTC | No data | ||
| Right | 1114680225 | 14:24478128-24478150 | CTCAAGTTAGGGAAGTGATCTGG | No data | ||||
| 1114680222_1114680225 | -9 | Left | 1114680222 | 14:24478114-24478136 | CCATGAGTATGGGTCTCAAGTTA | No data | ||
| Right | 1114680225 | 14:24478128-24478150 | CTCAAGTTAGGGAAGTGATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114680225 | Original CRISPR | CTCAAGTTAGGGAAGTGATC TGG | Intergenic | ||
| No off target data available for this crispr | |||||