ID: 1114683323

View in Genome Browser
Species Human (GRCh38)
Location 14:24505644-24505666
Sequence GGCCCCCAGAGTCTCCCTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 210}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114683322_1114683323 -7 Left 1114683322 14:24505628-24505650 CCAGCACACAGAAGAGGGCCCCC 0: 1
1: 0
2: 2
3: 19
4: 208
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683321_1114683323 -6 Left 1114683321 14:24505627-24505649 CCCAGCACACAGAAGAGGGCCCC 0: 1
1: 0
2: 0
3: 29
4: 251
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683316_1114683323 4 Left 1114683316 14:24505617-24505639 CCTGGGCCACCCCAGCACACAGA 0: 1
1: 0
2: 5
3: 43
4: 420
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683318_1114683323 -2 Left 1114683318 14:24505623-24505645 CCACCCCAGCACACAGAAGAGGG 0: 1
1: 0
2: 3
3: 47
4: 334
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683310_1114683323 28 Left 1114683310 14:24505593-24505615 CCGACCGTCCATAGGATACGATG 0: 1
1: 0
2: 0
3: 2
4: 12
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683311_1114683323 24 Left 1114683311 14:24505597-24505619 CCGTCCATAGGATACGATGCCCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683314_1114683323 20 Left 1114683314 14:24505601-24505623 CCATAGGATACGATGCCCTGGGC 0: 1
1: 0
2: 2
3: 2
4: 62
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683320_1114683323 -5 Left 1114683320 14:24505626-24505648 CCCCAGCACACAGAAGAGGGCCC 0: 1
1: 0
2: 2
3: 51
4: 417
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210
1114683315_1114683323 5 Left 1114683315 14:24505616-24505638 CCCTGGGCCACCCCAGCACACAG 0: 1
1: 0
2: 6
3: 48
4: 381
Right 1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG 0: 1
1: 0
2: 5
3: 28
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114683323 Original CRISPR GGCCCCCAGAGTCTCCCTGT AGG Exonic
900129385 1:1081028-1081050 AGCCCCCAGACTCCTCCTGTGGG - Intergenic
901701563 1:11047173-11047195 GGCGCCCACAGCCTCCCTGCAGG - Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
904418073 1:30374883-30374905 CGCCCACCCAGTCTCCCTGTTGG - Intergenic
904972981 1:34433625-34433647 GTCTCCCAGAGGTTCCCTGTGGG - Intergenic
905881122 1:41464427-41464449 GTTTCCCAGAGGCTCCCTGTGGG + Intergenic
906157077 1:43620033-43620055 TGCCCCTAGAGTCTCCCCTTAGG - Intronic
906315934 1:44786432-44786454 GACCCCCAGAGGCTCCCGGCGGG + Intronic
907919174 1:58896848-58896870 GGCGGCCAGTGTTTCCCTGTAGG + Intergenic
909200725 1:72687452-72687474 GACCCACAGAGAGTCCCTGTTGG - Intergenic
913251713 1:116917344-116917366 TGCCACCAGAGTCTCCCAGCTGG - Intronic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
920358743 1:205396830-205396852 AGCCCCCAGTGTATCCCTCTTGG - Intronic
921263880 1:213406469-213406491 GGCCACCAGACTTTCCCTGGAGG + Intergenic
1064965278 10:21009758-21009780 GGCCCCCAGAGAATTCCGGTGGG + Intronic
1065233200 10:23620582-23620604 AGCTCACACAGTCTCCCTGTGGG + Intergenic
1065485315 10:26231229-26231251 GGAGCCCTGAGTCTCCCTCTAGG - Intronic
1066321438 10:34307389-34307411 TGCTCCCAGAGTTTGCCTGTGGG - Intronic
1070719531 10:78746580-78746602 GTCCCCCAGAGGTTCGCTGTTGG + Intergenic
1072415879 10:95246449-95246471 GGCACCCAGGGTCACCCCGTAGG - Intronic
1074112748 10:110434009-110434031 CGCCCGCAGAGCCTCCCTGCAGG + Intergenic
1074130184 10:110567377-110567399 GGCCCTCGGAGTCTCCCTCTTGG + Intergenic
1074169404 10:110918683-110918705 GCCCCCGTGAGGCTCCCTGTGGG - Intronic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1076522062 10:131087674-131087696 GGCCCCCTCATCCTCCCTGTGGG + Intergenic
1076544677 10:131237245-131237267 GGCACTCAGGGTCTCCATGTGGG - Intronic
1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG + Intergenic
1076635454 10:131879373-131879395 AGTCCCCAGCCTCTCCCTGTGGG - Intergenic
1076802144 10:132835746-132835768 GGACCCCAGCGGCTCCCTGGTGG + Intronic
1078020467 11:7652430-7652452 GGCCTCCAGAGGTTGCCTGTTGG - Intronic
1078334043 11:10450463-10450485 GACCCCCAGAGTCTCGCGCTGGG + Intronic
1078474072 11:11615765-11615787 GTCTCCCAGACTCTGCCTGTAGG - Intronic
1081759691 11:45568606-45568628 GGCCCCCAGAAGGTTCCTGTAGG - Intergenic
1081993425 11:47349596-47349618 GGCCTCCGGGATCTCCCTGTGGG + Intronic
1083293005 11:61700154-61700176 GGCCCCCAGAGCCCTCCTGTTGG + Intronic
1083634191 11:64111313-64111335 GGCCCCCAGCGTCTGGCTGGAGG - Intronic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1083674179 11:64316297-64316319 GGAGGCCAGAGTCTCCCAGTGGG + Exonic
1083755558 11:64789948-64789970 GGCCCCCATAGTGTGCCTGCAGG - Exonic
1084150440 11:67285667-67285689 CGCTCCCAGTGTCTTCCTGTGGG + Exonic
1084539369 11:69776458-69776480 GGTCCCAGGAATCTCCCTGTGGG - Intergenic
1085448115 11:76614796-76614818 GTCCCACAGAGGCTCCCAGTGGG + Intergenic
1089460538 11:118650555-118650577 GGCCCCCAGGGTGGCCTTGTGGG - Intronic
1089494429 11:118901186-118901208 GGCCTCCAGAGAATCCCTGCTGG + Exonic
1091369071 11:135043834-135043856 TGCTCCCTGAGTCTCCCTGCAGG + Intergenic
1096153690 12:49330407-49330429 GGCCCCCAGAGGCCTTCTGTAGG + Exonic
1096153713 12:49330506-49330528 GGCCCCTAGAGTCCTGCTGTAGG + Exonic
1096153734 12:49330605-49330627 GGCCCCTAGAGTCCTACTGTAGG + Exonic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1096673599 12:53214638-53214660 GACCCTCAGAGCCTCCCTTTGGG + Intronic
1102241639 12:111328219-111328241 GTCCCACAGAGTCTGGCTGTGGG + Intronic
1104031815 12:125070210-125070232 TGCCCCCAGACCATCCCTGTAGG + Intronic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1104896726 12:132168457-132168479 GGCCCCCAGAGGACCCCAGTGGG - Intergenic
1105068345 12:133218760-133218782 GGTCCCCAGAGTTCCCCTGGGGG - Exonic
1107628473 13:42316683-42316705 GAGCCCCAGAGTCTTCCAGTGGG - Intronic
1107771527 13:43792307-43792329 GGGCCCCAGAGGCTTCATGTGGG + Intergenic
1108911027 13:55551355-55551377 GGCTCCCAAAGTCTCCCACTTGG - Intergenic
1113790027 13:113023361-113023383 GGGCCCCCGAGGCTCCCTGTGGG - Intronic
1113791918 13:113033516-113033538 GGTCCCCACTGTTTCCCTGTTGG + Intronic
1113839324 13:113349840-113349862 TGCCCCCAGAAACTTCCTGTAGG - Intronic
1113890060 13:113731016-113731038 GCACCCCAGACTCTGCCTGTGGG - Intronic
1114385274 14:22247613-22247635 AGCTCCCAGAGTCTTCCTGCTGG + Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1116413675 14:44655035-44655057 GGCCCTCAGAGACTTCATGTTGG - Intergenic
1116871058 14:50069639-50069661 GGCCCCCAGATTGAACCTGTAGG + Intergenic
1118782237 14:69016239-69016261 TGCTCCCAGAATCTCCCTCTGGG - Intergenic
1121342734 14:93115204-93115226 GGCCGCCAGACTCGGCCTGTGGG - Exonic
1124716259 15:32065308-32065330 GCTCCTCAGAGTCTCACTGTTGG + Intronic
1128887512 15:71302439-71302461 GCAACCCAGAGCCTCCCTGTGGG - Intronic
1128918506 15:71589550-71589572 GGCCCCATGTGTCACCCTGTTGG + Intronic
1129167205 15:73785371-73785393 AGCCCTCAGGGTTTCCCTGTTGG - Intergenic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1129697374 15:77748276-77748298 GGCCACCAGAGTTTGCCAGTGGG + Intronic
1129724935 15:77896884-77896906 GGCCACCAATGTCTCCCTGCTGG + Intergenic
1131830702 15:96352938-96352960 GGCCCCTAGAGTCCCCCCCTCGG + Intergenic
1132715169 16:1286497-1286519 GGCCCCCGTTGTCGCCCTGTGGG + Intergenic
1132976313 16:2712799-2712821 GGCCGCCCGAGTCGCCCTGCGGG + Exonic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133804851 16:9117601-9117623 TGTCCCCAGAGTAACCCTGTAGG + Exonic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1134392580 16:13833080-13833102 GGCCCCCACACTGTCTCTGTTGG - Intergenic
1135063482 16:19290218-19290240 GGCCCCCAAGGTCTCCCAGCTGG - Intronic
1136145144 16:28312130-28312152 GCAGCCCAGCGTCTCCCTGTTGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1137332333 16:47511015-47511037 GGTCCCCAGAGTTTTTCTGTTGG + Intronic
1139530794 16:67541813-67541835 ATCCCCCAGAGGCTCCCTGGGGG + Intronic
1139545865 16:67649247-67649269 GTCGTCCAGGGTCTCCCTGTGGG - Exonic
1139581320 16:67875510-67875532 GGCACTTAGACTCTCCCTGTGGG - Intronic
1139974192 16:70795884-70795906 GGCCCCCACTGTCTCACTGCTGG - Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1141241324 16:82267615-82267637 TGCCTCCAGAGTTCCCCTGTGGG - Intergenic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1143548512 17:7614600-7614622 GGCCCCCGGCGTCTCCCCGGAGG + Exonic
1144038165 17:11385731-11385753 TCCCCCCAGCCTCTCCCTGTTGG - Intronic
1145118259 17:20232118-20232140 GGACCCCAGAGTCCCCGTGTTGG - Intronic
1145241032 17:21241205-21241227 GGCCCTCAGGGGCTTCCTGTGGG + Exonic
1145759759 17:27419446-27419468 GGCTCCCAGATTCTGCCTGGCGG - Intergenic
1146183324 17:30710267-30710289 GGGCCCCAGAGGATCCGTGTCGG + Intergenic
1147978893 17:44262801-44262823 GGTCCCCAGAGCCTCCAGGTGGG + Intronic
1147980555 17:44271411-44271433 TGCCCACAGAGTCTCCCTCTGGG - Intergenic
1151445452 17:74160687-74160709 GGGCCTCAGAGTCACCGTGTAGG - Intergenic
1152312373 17:79559016-79559038 GGCTCCCAGGGTCTCCTGGTGGG - Intergenic
1152606702 17:81295086-81295108 GGGCCCCAGAGGCTGCCTGGAGG + Exonic
1152722728 17:81930849-81930871 AGCCCCCAGGGGCCCCCTGTAGG + Intergenic
1153892835 18:9534199-9534221 AGTCTCCCGAGTCTCCCTGTGGG + Intronic
1153947804 18:10032515-10032537 GGCCCCCAGGGCCTCGCTGGCGG + Intergenic
1156032912 18:32733724-32733746 TGCCCCCTGCTTCTCCCTGTGGG - Intronic
1156261048 18:35445311-35445333 TGTCCCCAGAGGCTCTCTGTAGG + Intronic
1156710967 18:39945101-39945123 GGCCCCCCAAGTCCCCCAGTGGG - Intergenic
1156833378 18:41522665-41522687 GGCTAACAGAGTCTCCCTATTGG + Intergenic
1157301834 18:46484945-46484967 GACCCCGAGAATCTCCCTCTTGG - Intronic
1157799578 18:50608552-50608574 GGCCCCCAAAATCTCTCTTTTGG - Intronic
1158795453 18:60840257-60840279 GGCCCCCAGAGTTCGCTTGTTGG - Intergenic
1159124471 18:64207168-64207190 TGCCCCCAGAGCCTACCTGCTGG - Intergenic
1159700614 18:71622184-71622206 GGCCCCCAAAGTTTGCATGTTGG + Intergenic
1160550995 18:79693845-79693867 GCCCCTCCGAGTCTCCCTGAAGG + Intronic
1160774197 19:847694-847716 GGCCACCTGAGTCTCCCGGGAGG - Intronic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161076899 19:2290226-2290248 GGCCGCCAGCGTCTCGTTGTGGG + Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161288474 19:3480446-3480468 GGCCCCCAGGGTCTCCATGACGG + Exonic
1161857360 19:6773399-6773421 GACCCCCAGAGTCTGGATGTGGG + Intronic
1161960992 19:7523019-7523041 GGCCGCCAGCTTCTCCCTCTGGG + Intronic
1162345691 19:10116864-10116886 GGGCCCCAGCGTATCCTTGTAGG + Exonic
1165011007 19:32846397-32846419 CGCCCACAGAGTCTCACTGATGG + Intronic
1165073301 19:33267872-33267894 CACCCCCAGAGTCTTCCTGAAGG + Intergenic
1166147889 19:40849882-40849904 GTCCACCAGAGCCTCCCTGACGG + Exonic
1166152022 19:40881653-40881675 GTCCACCAGAGCCTCCCTGACGG + Exonic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1167887812 19:52516398-52516420 GGGAGCCAGAGTTTCCCTGTAGG + Intergenic
927202074 2:20584127-20584149 TGTCCCCAGAGACTCCCTGTAGG + Intronic
931251428 2:60534185-60534207 GGCTCCCAGTGTCTCCCTCAAGG - Intronic
931459131 2:62434937-62434959 GGCACCTGGAGTCTCCATGTGGG + Intergenic
932701585 2:73995984-73996006 GCCACCCAGAGGCTCTCTGTGGG + Intronic
935875632 2:107504102-107504124 GGTCCCCAGAGTGGCACTGTAGG - Intergenic
936587583 2:113771844-113771866 GGACCACAGAGTCTACCTCTTGG - Intergenic
937756274 2:125542573-125542595 ACCCCCCAGAGTTTTCCTGTAGG - Intergenic
938794541 2:134706725-134706747 AGCCCCCAGAGGCTCCTTGTGGG - Intronic
945180650 2:207087741-207087763 GGCCTGCAGAGTCTCCATTTTGG + Intronic
946209219 2:218133925-218133947 GGCTGCCTGATTCTCCCTGTGGG - Intronic
946477198 2:220018419-220018441 TGCCTCCAGACTCCCCCTGTGGG + Intergenic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948081995 2:235214219-235214241 TGGCCCTACAGTCTCCCTGTTGG + Intergenic
1168813377 20:720680-720702 GGCCTGCAGAGTCACCCTCTAGG + Intergenic
1170376974 20:15710867-15710889 GGCCCCCAGAGACTACTTTTGGG + Intronic
1170570564 20:17629935-17629957 GGCCTCCTCACTCTCCCTGTGGG + Exonic
1173304753 20:41837551-41837573 GGCTCCCAGAGTTCCCCAGTGGG + Intergenic
1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG + Intergenic
1173525808 20:43731737-43731759 GCCCCCCAGAGCATCCCTGGAGG + Intergenic
1175827046 20:61942042-61942064 GGCCCCCAGAGCTGCCCTTTGGG - Intergenic
1175936483 20:62516584-62516606 GGCCCCCATAGTCTCCTGCTGGG - Intergenic
1179566398 21:42251722-42251744 GGCCCCCACTGTCTCCCTCTAGG - Intronic
1180877402 22:19181037-19181059 GGCCCCCAGAGCTTCCCAGTGGG + Intronic
1181063089 22:20291277-20291299 GCCTCCCAGAGCCTCTCTGTAGG - Intergenic
1184116715 22:42426665-42426687 GGCCTCCCCAGTCCCCCTGTAGG - Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185193714 22:49454922-49454944 GGCCCCCAGGGTAGCCCTGATGG - Intronic
949541615 3:5036889-5036911 GGTCCCCAGATTCTCCTTCTAGG + Intergenic
951217696 3:20040408-20040430 CGCCGCCAGGGTCTCCCTCTCGG - Exonic
952059210 3:29487182-29487204 CACCCCAAGAGTCTCTCTGTTGG - Intronic
953578754 3:44134552-44134574 AGCTCCCAGAGTATCCCTATGGG - Intergenic
954117211 3:48473482-48473504 GGGCCCCAGGGTCGCCCTCTGGG - Intronic
954134803 3:48577012-48577034 GGTCCCCAGGTTCTCCCTGTGGG + Exonic
956374383 3:68598569-68598591 GGCTCCCAGAGTTTCCCAGAAGG - Intergenic
962370076 3:134814002-134814024 GGCCCCCAGAGTCTACCCCGGGG + Intronic
964690482 3:159444190-159444212 GTCCCACACAGTCTCCCTGAGGG - Intronic
970937136 4:21586429-21586451 CTCCCCCAGTGTCTCCCTTTGGG + Intronic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
981300252 4:143178799-143178821 GGTCCCCAGTGACTCCCTTTGGG + Intergenic
981781603 4:148436826-148436848 GGCTACCACAGTCTCCCTGAAGG - Exonic
985641782 5:1066803-1066825 TGCCTCCAGAGTCTCCCGGGAGG - Intronic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
990370205 5:55110014-55110036 GGCTTCCAGAATCTCCCTGGAGG - Exonic
994492451 5:100463913-100463935 CGCCCACAGAGTCTCCCTGATGG - Intergenic
998256262 5:140591202-140591224 GACCCCCAGAACCTCCATGTGGG + Intronic
998339843 5:141407918-141407940 GGCGCCCAGAGGCTCCGTGCGGG - Intronic
998340927 5:141417577-141417599 GGCGCCCAGAGGCTCTGTGTGGG - Intronic
998485216 5:142496230-142496252 GGCCCCCAGATTCCCCATTTTGG - Intergenic
998514720 5:142742493-142742515 ATTCCCCAGAGTGTCCCTGTGGG + Intergenic
1002175310 5:177398196-177398218 GCCCCCCAGGGTCTTCCTGGAGG + Exonic
1002839489 6:893765-893787 AGCCTCCAGAGACTCACTGTGGG - Intergenic
1006297516 6:33176517-33176539 GGGCCTCAGAGTGTCACTGTGGG + Intronic
1006594292 6:35181834-35181856 TGCCCTCAGGGCCTCCCTGTCGG + Intergenic
1006801020 6:36759694-36759716 GGTCCACGGAGCCTCCCTGTGGG - Intronic
1006939123 6:37739956-37739978 GGCCCCCAGCGTGTCCCATTTGG - Intergenic
1007123304 6:39401501-39401523 GGCCCCTAGAGTCTCCAAGTGGG - Intronic
1007293781 6:40805989-40806011 GGCTCCCAGAGCTCCCCTGTGGG + Intergenic
1009995420 6:70890311-70890333 CTGCCACAGAGTCTCCCTGTGGG + Intronic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1016927021 6:149361146-149361168 GCCCCACAGAGTCTCCATGGGGG - Intronic
1018987991 6:168652327-168652349 GGCCCCTGGATTCTGCCTGTTGG - Intronic
1019267233 7:124661-124683 GGCACCCAGCTTCTCACTGTTGG + Intergenic
1019911425 7:4102637-4102659 GGCCACCAGAGCCTCCCAGCAGG + Intronic
1023140442 7:37096832-37096854 GGCCCCAAGAGTCTTCGTTTGGG - Intronic
1023876287 7:44288071-44288093 GGCCCCTAGAGTGTCCCAGCAGG + Intronic
1023980570 7:45067680-45067702 AGCCCCAGGAGTCTCACTGTGGG + Intronic
1024558409 7:50623241-50623263 TGCCCCCAGGTTCTACCTGTTGG - Intronic
1025942294 7:66083181-66083203 TGCCCCCTGGGTGTCCCTGTAGG - Intronic
1029352427 7:100023712-100023734 GGCCCCGAGAGGCTCTCAGTCGG + Exonic
1029490711 7:100868559-100868581 CGCTCCCAGCGTCTCCCTATGGG + Exonic
1032524891 7:132572652-132572674 GCCCCCTTCAGTCTCCCTGTGGG + Intronic
1033264810 7:139875832-139875854 GGCCAGCAGAGTCCCCCCGTGGG - Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1035258231 7:157645755-157645777 GGGCCCCAGAGTCCCGGTGTGGG + Intronic
1036634310 8:10538469-10538491 GCCCCCCACTGTCACCCTGTGGG - Exonic
1036677463 8:10846859-10846881 GGCTTCCCGAGTCTCACTGTTGG + Intergenic
1037837275 8:22221607-22221629 GGCGCCCAAAGGCTCCCTGGGGG - Exonic
1037886742 8:22599589-22599611 GGCCCCCAGACACTCCCAGCGGG - Intronic
1038032005 8:23650834-23650856 TGCCCACGGAGTCTCCCTGATGG - Intergenic
1040870954 8:52100176-52100198 GGCCCCCAGAGCTCCCCTGTCGG - Intergenic
1047254676 8:123206557-123206579 GGCCCCCAGAGTCTGCGCTTAGG - Intronic
1048635345 8:136289450-136289472 GGCCCCCAGAGTTAGCCTGTCGG + Intergenic
1049369582 8:142257465-142257487 GGCTCCCAGAGTCTCCTGGCTGG - Intronic
1049449947 8:142655182-142655204 GGTCCCCAGGGTCTCTGTGTGGG - Intergenic
1051629253 9:19127355-19127377 GGCCCCCAGCGGCGCCCAGTTGG - Intronic
1056813143 9:89779982-89780004 CCCCACCAGAGTCTCCCTGTGGG - Intergenic
1057492744 9:95534518-95534540 GTTGCCCAGAGTCTCCCTGCAGG + Intergenic
1060666033 9:125432767-125432789 GGGCCCCAGAGCTTCCCTGGAGG + Intergenic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1062047499 9:134431299-134431321 CGCCCCCAGCGTCTCCATGGAGG + Intronic
1062720332 9:138038631-138038653 AGAGCCCAGAGTGTCCCTGTGGG + Intronic
1185822061 X:3215117-3215139 GGAGCACAGAGACTCCCTGTTGG - Intergenic
1186652612 X:11577352-11577374 GTCTCGCAGAGTCTCCCTGCAGG - Intronic
1187251037 X:17598101-17598123 AGCCCCCTGAGTCTACCTGCTGG - Intronic
1188841348 X:35022039-35022061 GACACCCAGAGTTTCCCGGTGGG - Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic
1200204764 X:154307897-154307919 GCCCCCCAGAGACTCCCTTTTGG - Intronic