ID: 1114684376

View in Genome Browser
Species Human (GRCh38)
Location 14:24514168-24514190
Sequence GAAGACCAGCAAAATGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114684369_1114684376 14 Left 1114684369 14:24514131-24514153 CCCTAGACTCACCAGATGTGGCT No data
Right 1114684376 14:24514168-24514190 GAAGACCAGCAAAATGATCAGGG No data
1114684370_1114684376 13 Left 1114684370 14:24514132-24514154 CCTAGACTCACCAGATGTGGCTT No data
Right 1114684376 14:24514168-24514190 GAAGACCAGCAAAATGATCAGGG No data
1114684373_1114684376 3 Left 1114684373 14:24514142-24514164 CCAGATGTGGCTTCAGGAGGCAA No data
Right 1114684376 14:24514168-24514190 GAAGACCAGCAAAATGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114684376 Original CRISPR GAAGACCAGCAAAATGATCA GGG Intergenic
No off target data available for this crispr