ID: 1114690065

View in Genome Browser
Species Human (GRCh38)
Location 14:24573324-24573346
Sequence ACATATGGCAAAAGGGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114690065_1114690076 18 Left 1114690065 14:24573324-24573346 CCCTTGCCCCTTTTGCCATATGT No data
Right 1114690076 14:24573365-24573387 GTTGTCTGTGAACCAGAAAATGG 0: 1
1: 1
2: 14
3: 86
4: 413
1114690065_1114690075 -4 Left 1114690065 14:24573324-24573346 CCCTTGCCCCTTTTGCCATATGT No data
Right 1114690075 14:24573343-24573365 ATGTGGACACAGGGAGAGGATGG 0: 1
1: 0
2: 14
3: 246
4: 1090
1114690065_1114690074 -8 Left 1114690065 14:24573324-24573346 CCCTTGCCCCTTTTGCCATATGT No data
Right 1114690074 14:24573339-24573361 CCATATGTGGACACAGGGAGAGG 0: 1
1: 1
2: 15
3: 206
4: 1372
1114690065_1114690077 19 Left 1114690065 14:24573324-24573346 CCCTTGCCCCTTTTGCCATATGT No data
Right 1114690077 14:24573366-24573388 TTGTCTGTGAACCAGAAAATGGG 0: 1
1: 1
2: 17
3: 103
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114690065 Original CRISPR ACATATGGCAAAAGGGGCAA GGG (reversed) Intergenic
No off target data available for this crispr