ID: 1114693472

View in Genome Browser
Species Human (GRCh38)
Location 14:24606529-24606551
Sequence GGCAAGAATCCCCAAGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114693472_1114693482 6 Left 1114693472 14:24606529-24606551 CCCACCCCTTGGGGATTCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1114693482 14:24606558-24606580 CCAGAGATGGTCAGGCCCAGAGG 0: 1
1: 0
2: 6
3: 66
4: 525
1114693472_1114693479 -2 Left 1114693472 14:24606529-24606551 CCCACCCCTTGGGGATTCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1114693479 14:24606550-24606572 CCTCTGTCCCAGAGATGGTCAGG 0: 1
1: 0
2: 4
3: 17
4: 199
1114693472_1114693483 10 Left 1114693472 14:24606529-24606551 CCCACCCCTTGGGGATTCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1114693483 14:24606562-24606584 AGATGGTCAGGCCCAGAGGAAGG 0: 1
1: 0
2: 2
3: 35
4: 345
1114693472_1114693477 -7 Left 1114693472 14:24606529-24606551 CCCACCCCTTGGGGATTCTTGCC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1114693477 14:24606545-24606567 TCTTGCCTCTGTCCCAGAGATGG 0: 1
1: 0
2: 4
3: 34
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114693472 Original CRISPR GGCAAGAATCCCCAAGGGGT GGG (reversed) Exonic
903657370 1:24957545-24957567 GGGAAGGCTCCCCAAGGGGGCGG + Intronic
904047596 1:27617911-27617933 AGAAAGAATCCCCAAGGGAGAGG - Intronic
906143349 1:43546301-43546323 GGCAGGCATTCCCAAGGGGTGGG + Intronic
907322935 1:53617006-53617028 TGCATGAAGCCCCATGGGGTGGG - Intronic
910746897 1:90583871-90583893 GGGAAGGAGCCCCATGGGGTAGG - Intergenic
916483541 1:165236409-165236431 GGCAAGAATCTGGCAGGGGTGGG - Intronic
919871153 1:201822521-201822543 GCCAAGAATCCCTTTGGGGTCGG - Exonic
922340108 1:224648147-224648169 GGTAAGAATCCCAAAGTGTTGGG - Intronic
923142345 1:231171272-231171294 GGCAGGAATCTCTAAGGGGTGGG + Intronic
1070350602 10:75588469-75588491 GGCAAGAATACAGCAGGGGTGGG - Intronic
1070412946 10:76160971-76160993 CGCAAGCAACCGCAAGGGGTGGG + Intronic
1074125247 10:110524001-110524023 GTCAAGTATCACCATGGGGTTGG + Intergenic
1076140777 10:128077334-128077356 GCCAAGGATCCCGTAGGGGTTGG + Intronic
1077287649 11:1774958-1774980 GGAAGGCATCCCCAAGGGGAGGG + Intergenic
1079014991 11:16861227-16861249 GTCAAGAATCATCAAGGGCTAGG + Intronic
1079099867 11:17534359-17534381 GGCCAGAAATCCCAAGGGCTGGG - Intronic
1083478360 11:62928093-62928115 GGCAAGAGGCGCCAAGGGGGCGG - Intergenic
1084676183 11:70636089-70636111 GGGAAGGCTCCCCAAGGGGAAGG - Intronic
1085252505 11:75152909-75152931 GGGAAGAGTCCCCAAGGGAGAGG + Intronic
1093213300 12:16333061-16333083 GACAAAAATCCCCATGAGGTAGG + Intergenic
1095227089 12:39690085-39690107 GGCAAGAGTCACCAATGGGATGG + Intronic
1095579665 12:43783022-43783044 GTGAAGAATCCCCAAGAGGCAGG + Intronic
1095958041 12:47817804-47817826 GGCAAGCATGCCCAAGGACTTGG - Intronic
1103521115 12:121537513-121537535 GGCGGGAACCCCCAAGGGCTCGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106214696 13:27685669-27685691 GGCAAGTATGCCCAAGGGATGGG + Intergenic
1110304122 13:73965037-73965059 GGCAGGCAGTCCCAAGGGGTAGG + Intronic
1114527269 14:23374439-23374461 AGTATGAATCTCCAAGGGGTAGG - Intronic
1114693472 14:24606529-24606551 GGCAAGAATCCCCAAGGGGTGGG - Exonic
1117436383 14:55718690-55718712 GGAAAGAAGCCCAAAAGGGTGGG - Intergenic
1119204043 14:72780932-72780954 TGAAAGAATCGCTAAGGGGTGGG + Intronic
1119482983 14:74970860-74970882 GGAAACAAACGCCAAGGGGTTGG + Intergenic
1122146507 14:99692023-99692045 TGCAAGAGTCCCCAAGGAGTGGG - Intronic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1128384045 15:67134620-67134642 GGAAAGAAAGCCCAAGGGGCTGG - Intronic
1133319758 16:4905768-4905790 GGCCTGACTCCCCAGGGGGTTGG + Intronic
1133695245 16:8256977-8256999 GGCAGGAATCACCTAGGAGTTGG - Intergenic
1133899028 16:9955909-9955931 GGCAGAAATCCCCAGGGGCTTGG + Intronic
1135953612 16:26937614-26937636 GGCAAGGAGCCCCAAGTGGTAGG + Intergenic
1139324266 16:66139886-66139908 GGAAAGAATCTCCAATGGGGAGG - Intergenic
1140897250 16:79335614-79335636 GGCAGGGACCCCCAAGGGGAAGG + Intergenic
1141506895 16:84483789-84483811 GGCAAGAGTCCCCATGGAGAAGG + Intronic
1142114671 16:88350403-88350425 GGCCAGAATCGCCTAGGGGAGGG + Intergenic
1142190924 16:88716971-88716993 GGCCAGAACCCCCAGGGGATGGG + Intronic
1145010317 17:19364222-19364244 GGGGAGTCTCCCCAAGGGGTGGG + Intronic
1148284176 17:46373110-46373132 GGGAACAAGCCCCAAGGGATGGG - Intergenic
1148306397 17:46591031-46591053 GGGAACAAGCCCCAAGGGATGGG - Intronic
1153683286 18:7521569-7521591 GGCAAGTGTCCTCAAGAGGTGGG + Intergenic
1156312761 18:35940055-35940077 GGGAGGAAGCCCCAATGGGTTGG - Intergenic
1156783486 18:40880841-40880863 GGCAAGAAAGCCAAAGGGATGGG + Intergenic
1157584099 18:48790443-48790465 GGCATGAGTCACCAAGGGGCAGG + Intronic
1160946217 19:1645176-1645198 CTCCAGAATCCCCCAGGGGTGGG - Intronic
1161112857 19:2479439-2479461 GGTAGGAGTCCCGAAGGGGTTGG + Intergenic
925302185 2:2825355-2825377 GGCCAGAAGCCCTAAGGAGTTGG + Intergenic
927198001 2:20561179-20561201 GGGGAGCATCCCCAAGGAGTGGG - Intronic
930943828 2:57047061-57047083 GGCAAGAATACTCAAGGTCTGGG - Intergenic
932557711 2:72840170-72840192 GGGAAGAATCCCCAGGGGACAGG - Intergenic
935281905 2:101525697-101525719 TGAAAGAATGCCCAAGGGGCTGG + Intergenic
935831663 2:107006927-107006949 GGGAAGTATCCCCAAGGGAGAGG - Intergenic
949022439 2:241749127-241749149 GGCAGGAATCCCCAGGAAGTGGG - Intronic
1170356702 20:15499830-15499852 GCCAAGAATCACCATGAGGTAGG + Exonic
1172192039 20:33067888-33067910 GCCCAGAATCCCTAAGGGGCAGG - Intronic
1172621198 20:36319725-36319747 CCCAAGAATCCCTAAGGAGTTGG - Intronic
1178695001 21:34785470-34785492 GTGGAGAAACCCCAAGGGGTGGG + Intergenic
1179026250 21:37681315-37681337 GGGAGGAATTCCCAAGGTGTAGG + Intronic
1182254583 22:29029158-29029180 GGCAAGGAGCTCCAAGGAGTTGG + Intronic
1183111035 22:35648679-35648701 GGACAGAGCCCCCAAGGGGTTGG + Intronic
1184042091 22:41950351-41950373 GGGAAGAATCACAAAGGGGCAGG - Intergenic
958968266 3:100582764-100582786 GGCCAGTTTTCCCAAGGGGTAGG + Intergenic
959321955 3:104887885-104887907 GGCAGAAATCCCCCAGGGTTTGG + Intergenic
960141051 3:114152250-114152272 GGGAAGAATCCCCAAGGAGGGGG - Intronic
964731948 3:159876960-159876982 GGTAATAATCCCCAAGGAGGAGG - Intronic
968880708 4:3297698-3297720 GGCTCCAATCCCAAAGGGGTGGG - Intronic
973734748 4:53860284-53860306 TGCAAAAATCCTCAAGGGATAGG + Intronic
976528084 4:86116593-86116615 GCCAAGAAACCCCACAGGGTGGG - Intronic
977007638 4:91591034-91591056 GCCAAATGTCCCCAAGGGGTGGG - Intronic
978118417 4:105049836-105049858 GGACAGAACCCCCAAGGGGAAGG + Intergenic
979618545 4:122772124-122772146 GGGAAGATTTCCCAAGGCGTAGG + Intergenic
985530087 5:429063-429085 GACACGAATCCCCAAGGGCAGGG - Intronic
992914039 5:81429925-81429947 GTCAAGAAACCCCAAGGACTTGG + Intronic
996784957 5:127228674-127228696 GGCAAAAATCTCCAGCGGGTGGG + Intergenic
998511606 5:142718702-142718724 GGACAGAAGCCCCAAGGGGCAGG + Intergenic
999724118 5:154420799-154420821 GACTAGGATCCCAAAGGGGTTGG + Exonic
1012358207 6:98342783-98342805 AGCAAGAATCCACAACAGGTAGG - Intergenic
1018318577 6:162582998-162583020 GGCGATAATCCCCAAGCGGATGG + Intronic
1021455257 7:20823197-20823219 GGCAACAGTGCCCTAGGGGTTGG - Intergenic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1026957159 7:74384782-74384804 AGCAAGAATACCCAAGAGTTTGG - Intronic
1027556039 7:79665883-79665905 AGCAAAAAACCCAAAGGGGTTGG - Intergenic
1029361550 7:100091824-100091846 GGCAACTATCCCAAAGGGGAGGG + Exonic
1029705825 7:102275150-102275172 GGCAGAAATCCCCCAGGGCTGGG + Intronic
1030200096 7:106894123-106894145 GGAAACAATCCACAATGGGTTGG - Intronic
1034155477 7:148952890-148952912 GTCAAGAATATCCATGGGGTCGG - Intergenic
1039890587 8:41682956-41682978 GGCTGGAATCCCCAAGGGGGTGG + Intronic
1040111880 8:43570342-43570364 GGCAAAAGTCCCCAGGGGGACGG - Intergenic
1042373057 8:68014616-68014638 TGCCAGCATCCCCAAGTGGTTGG + Intronic
1046039733 8:108887907-108887929 CGTAAGAATCCCCCAGGGATAGG - Intergenic
1046139509 8:110071869-110071891 GTCAAGACTCATCAAGGGGTAGG - Intergenic
1048800059 8:138186911-138186933 TCCACGAATCACCAAGGGGTGGG - Intronic
1053009539 9:34625317-34625339 GGAAGGACTTCCCAAGGGGTGGG - Intronic
1057529799 9:95834435-95834457 TTCAAGAAGCCCCAAGGTGTTGG + Intergenic
1062466305 9:136683080-136683102 GGGAAGAATCCAAAATGGGTGGG + Intronic
1186418180 X:9401457-9401479 GTGAAAAATCCCCAAGGGGAAGG + Intergenic
1189165901 X:38860906-38860928 GCCAAAAATTCCCAAGGTGTTGG - Intergenic
1189408350 X:40746416-40746438 GGGAGGGATCCCCAAGAGGTGGG + Intergenic
1190730347 X:53221750-53221772 GGGAGGAAGCCCCAGGGGGTGGG + Intronic
1191250337 X:58257186-58257208 GTCAAGAATACCCCAGGGGAAGG + Intergenic
1191258548 X:58290428-58290450 GGCAAGAAGACCCCAGGGGAAGG + Intergenic
1194986210 X:100492370-100492392 GGCATGATTCCCCAAGGGACAGG - Intergenic