ID: 1114694767

View in Genome Browser
Species Human (GRCh38)
Location 14:24616378-24616400
Sequence ATGGTGAAGGCCATGCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114694763_1114694767 23 Left 1114694763 14:24616332-24616354 CCTTGGCTCTGTTGGAGGACACA No data
Right 1114694767 14:24616378-24616400 ATGGTGAAGGCCATGCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114694767 Original CRISPR ATGGTGAAGGCCATGCTTAG AGG Intergenic
No off target data available for this crispr