ID: 1114696120

View in Genome Browser
Species Human (GRCh38)
Location 14:24629392-24629414
Sequence ACAGGGATTATGCTTCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114696114_1114696120 21 Left 1114696114 14:24629348-24629370 CCTGATTCTAGTTTCATTCTGTA No data
Right 1114696120 14:24629392-24629414 ACAGGGATTATGCTTCTGAGTGG No data
1114696113_1114696120 25 Left 1114696113 14:24629344-24629366 CCTTCCTGATTCTAGTTTCATTC No data
Right 1114696120 14:24629392-24629414 ACAGGGATTATGCTTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114696120 Original CRISPR ACAGGGATTATGCTTCTGAG TGG Intergenic
No off target data available for this crispr