ID: 1114696633

View in Genome Browser
Species Human (GRCh38)
Location 14:24632416-24632438
Sequence GGCCCACAATATCAAAGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114696633_1114696640 20 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696640 14:24632459-24632481 GCTGCACAGAGAGCAGAGTGAGG 0: 2
1: 0
2: 4
3: 38
4: 477
1114696633_1114696643 26 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696643 14:24632465-24632487 CAGAGAGCAGAGTGAGGATGGGG 0: 2
1: 1
2: 6
3: 101
4: 774
1114696633_1114696635 -4 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696635 14:24632435-24632457 GGCCCCCAAGGTGACATTTATGG 0: 2
1: 0
2: 2
3: 5
4: 110
1114696633_1114696642 25 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696642 14:24632464-24632486 ACAGAGAGCAGAGTGAGGATGGG 0: 2
1: 0
2: 7
3: 68
4: 611
1114696633_1114696645 30 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696645 14:24632469-24632491 GAGCAGAGTGAGGATGGGGGTGG 0: 2
1: 3
2: 13
3: 143
4: 1219
1114696633_1114696644 27 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696644 14:24632466-24632488 AGAGAGCAGAGTGAGGATGGGGG 0: 2
1: 0
2: 12
3: 96
4: 948
1114696633_1114696641 24 Left 1114696633 14:24632416-24632438 CCTGTTCTTTGATATTGTGGGCC 0: 1
1: 1
2: 0
3: 7
4: 108
Right 1114696641 14:24632463-24632485 CACAGAGAGCAGAGTGAGGATGG 0: 2
1: 1
2: 8
3: 73
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114696633 Original CRISPR GGCCCACAATATCAAAGAAC AGG (reversed) Exonic
902007952 1:13247086-13247108 GGTCAATAATATCAAAGACCTGG + Intergenic
902911865 1:19604583-19604605 GACCCACAATAGCCAAGATCAGG - Intronic
903949084 1:26983850-26983872 GGTCCACAATGTCAAGGAGCTGG + Intergenic
907520542 1:55020692-55020714 GGCCCAGAATCTCCAGGAACTGG - Intergenic
908276641 1:62480037-62480059 GGGCCACAATATTGAAGAATTGG - Intronic
909598359 1:77432423-77432445 TGGCCACAATCTCAAAGCACTGG + Intronic
915025107 1:152820622-152820644 GGCCCACCATACCAGAGAAAGGG + Intergenic
915848872 1:159299555-159299577 GGCTCCCAACATCAAATAACAGG + Intronic
917458628 1:175208026-175208048 GGGGCACAGAATCAAAGAACTGG - Intergenic
919955014 1:202405105-202405127 GACTCACATTACCAAAGAACAGG - Intronic
920957342 1:210631611-210631633 GGCACACAATTTCAAAGACCAGG + Intronic
922788897 1:228298899-228298921 GGCCCACAGTATCACAGGAGAGG - Intronic
1068396794 10:56472532-56472554 GACCAACAATATGAAGGAACTGG + Intergenic
1074136264 10:110629339-110629361 AGCCAACAAAATCAAACAACAGG - Intergenic
1080099739 11:28445954-28445976 GGGACACAATATAAAATAACAGG - Intergenic
1080461628 11:32459714-32459736 GGCCCATAAAATGAAAGAACTGG + Intergenic
1080814309 11:35739060-35739082 GTCCCCTAATATCAAACAACTGG - Intronic
1082085737 11:48048117-48048139 GGCAAACACTATCAAAGAAAAGG - Intronic
1086112339 11:83213238-83213260 GGTCCACAACATCAAGGAGCTGG + Intronic
1094069029 12:26392459-26392481 GGCCCAGAAGATCAAACAGCTGG - Intronic
1100874484 12:98947601-98947623 AGCCCTCAATATCAAATTACTGG - Intronic
1106697147 13:32187572-32187594 GGCCCACATTGTCAAAGACAGGG - Exonic
1109442402 13:62393107-62393129 GGCCCAGAACATCAATGAAGAGG - Intergenic
1110908457 13:80922951-80922973 AGGCCATAAAATCAAAGAACTGG - Intergenic
1114693688 14:24607704-24607726 GGCCCACAATATCAAGGAACAGG - Exonic
1114696633 14:24632416-24632438 GGCCCACAATATCAAAGAACAGG - Exonic
1115492779 14:33974196-33974218 AGCCCAAAATAGCAATGAACAGG + Intronic
1116006646 14:39299011-39299033 GGACCACAATCTCAAACTACTGG - Intronic
1116844689 14:49854113-49854135 GGCCCAAAATATGAAAGCATTGG + Intergenic
1118125993 14:62905035-62905057 TGCCCACAGAATCAAAGAGCTGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1129955557 15:79633680-79633702 GGGCTTCAATATCAAAGATCTGG + Intergenic
1131115709 15:89794012-89794034 AACCCCCAATAACAAAGAACAGG + Intronic
1135853583 16:25986438-25986460 TGCCCTCAATATCACAAAACAGG + Intronic
1137353126 16:47731944-47731966 TGGCCACATTTTCAAAGAACTGG + Intergenic
1140153717 16:72400594-72400616 GGCCTACAAAATGAAACAACTGG + Intergenic
1147518641 17:41146757-41146779 GGCTCACAATAACAAGGAGCAGG - Intergenic
1149688864 17:58556450-58556472 GGCTCACACAATCAAAGTACAGG - Intergenic
1150535089 17:66030002-66030024 GAACCACATGATCAAAGAACTGG - Exonic
1157763201 18:50280182-50280204 GGCCCAGAATAGGAAAGAATGGG - Intronic
1157879025 18:51301754-51301776 GGCCCACATTATAAATGAATAGG - Intergenic
1161457363 19:4376227-4376249 GGCCCACAGTCACAAAGAAATGG - Intronic
1162183309 19:8885684-8885706 GACCCACAATATCACTGAGCTGG - Exonic
1162255729 19:9488001-9488023 GGTCCTCAATATCACAGCACTGG + Intronic
1163394734 19:17053138-17053160 GTCCCACAATCTCAGAGCACGGG - Intronic
1165145576 19:33727948-33727970 GGCCCACACTCCCAAAGAGCAGG + Intronic
927607766 2:24503485-24503507 GCCCCATATTATCAAACAACAGG - Intronic
928244996 2:29619413-29619435 GGCTCACACGCTCAAAGAACAGG - Intronic
928423846 2:31161646-31161668 GACCCACAAACTCAAACAACAGG + Intergenic
929885866 2:45877886-45877908 CTCTCAAAATATCAAAGAACAGG + Intronic
931651238 2:64470830-64470852 GGCCCAGAATATAAAATATCAGG - Intergenic
933428486 2:82144195-82144217 GGTCCTCAATATGAGAGAACTGG + Intergenic
936904135 2:117517107-117517129 GACCCATAAGATCACAGAACTGG - Intergenic
941262098 2:163310334-163310356 GGGCCACAATTTCAAAGACAAGG - Intergenic
941756547 2:169192683-169192705 TGTCCACAAAATAAAAGAACAGG + Intronic
942123518 2:172801675-172801697 GCCCCAGAATCACAAAGAACTGG - Intronic
943084266 2:183293819-183293841 GTCCTACAAAATCAAGGAACTGG + Intergenic
945797432 2:214382402-214382424 GGCCCACAAAATCTAAGGTCAGG - Intronic
947444487 2:230153525-230153547 GCCCCACAACCTCAAGGAACTGG - Intergenic
1168864979 20:1078600-1078622 GGCTCACAAAATCCCAGAACAGG - Intergenic
1176418456 21:6494633-6494655 ACCCCCCAAAATCAAAGAACTGG + Intergenic
1177300756 21:19242705-19242727 GGCACAGAGTAGCAAAGAACTGG - Intergenic
1179693949 21:43102955-43102977 ACCCCCCAAAATCAAAGAACTGG + Intronic
1180625894 22:17193138-17193160 GGTCCACAACATCAAGGAGCTGG + Intronic
1183007018 22:34912047-34912069 GGCCCGCAAGATCGAGGAACTGG - Intergenic
1184577240 22:45380292-45380314 GGCCCACAATAACACACATCTGG - Intronic
949274323 3:2260201-2260223 GGCCCAAAATATCAATGGGCTGG - Intronic
950682147 3:14592775-14592797 GGGCCAGAATTCCAAAGAACAGG - Intergenic
951882173 3:27490201-27490223 GGTTCACACTATCAAGGAACAGG - Intergenic
961530275 3:127536329-127536351 GGCACACAAGAGCAAAGAAAGGG + Intergenic
964109362 3:153073036-153073058 GGCCCACAATCAGAAAGATCGGG + Intergenic
966671508 3:182531391-182531413 AGCTCACAATATCAAAGATATGG + Intergenic
968851574 4:3083855-3083877 TACCCATAATATCTAAGAACTGG + Intronic
970205122 4:13648145-13648167 GGCCCACAAGGTCAAGGAGCAGG - Intergenic
970373101 4:15428674-15428696 AGCCCCCAAAAGCAAAGAACTGG + Intronic
976253483 4:83077220-83077242 GGGACAGAATATCCAAGAACTGG + Intergenic
979684972 4:123501925-123501947 AGCCAAGAATAACAAAGAACAGG + Intergenic
980321645 4:131287611-131287633 GGCCCACATGTTCAAACAACAGG - Intergenic
980767824 4:137331207-137331229 GGCATACAATATAAAATAACCGG - Intergenic
988062402 5:26188605-26188627 GTCCTACAATAGCATAGAACTGG - Intergenic
988478150 5:31606260-31606282 GACTCACAAAAGCAAAGAACCGG + Intergenic
993325674 5:86532761-86532783 GCCCCACAATATGGAACAACTGG - Intergenic
994373447 5:98992646-98992668 TGTTCACAATAGCAAAGAACTGG + Intergenic
997743957 5:136282659-136282681 GTCTCACAATATCAAAATACTGG - Intronic
1001281198 5:170387691-170387713 TTCCCACAAGATCACAGAACAGG - Intronic
1005553921 6:26954149-26954171 GGCCAACAAAAACAAACAACGGG + Intergenic
1005612220 6:27537354-27537376 GGGCCACAACATGAAAGAAAAGG + Intergenic
1008843454 6:55933749-55933771 GGACCACTTTTTCAAAGAACAGG + Intergenic
1012069085 6:94588981-94589003 GTCCCACAATCTCAAAAACCAGG + Intergenic
1012186473 6:96223309-96223331 GGCCCACAATAGCCAAGATTTGG - Intergenic
1014155232 6:118102147-118102169 GGCACACAATAACAATGTACAGG + Intronic
1016169588 6:140994803-140994825 GGTCCATAATTTCATAGAACTGG + Intergenic
1018328463 6:162700549-162700571 GGATCACAATATCAAACTACAGG + Intronic
1023608748 7:41953798-41953820 GGCCCACAATATGCAGGAAGAGG - Intergenic
1023899974 7:44468130-44468152 GGTCCACAACATCAAGGAGCTGG + Intronic
1024324740 7:48100736-48100758 AACCAACACTATCAAAGAACAGG - Intronic
1031778812 7:125937223-125937245 GGCCCACAATGTAAAAAAACTGG - Intergenic
1033542535 7:142370424-142370446 TGTCAATAATATCAAAGAACAGG - Intergenic
1033754149 7:144384087-144384109 GGGCCACTATATCAAAACACTGG - Intergenic
1034115557 7:148580631-148580653 GGTCCACAATGTCAAGGAGCTGG + Intergenic
1038100799 8:24372393-24372415 TGTTCACAATAGCAAAGAACTGG + Intergenic
1045457991 8:102400823-102400845 GACACACAAAATCAAGGAACAGG + Intronic
1048311534 8:133326230-133326252 GGTCCACAATGTCAAGGAGCTGG + Intergenic
1048454525 8:134565900-134565922 GGCCCAGAATATCAAGGGTCTGG + Intronic
1048988900 8:139750014-139750036 GGCCCACACAATCCAAGACCGGG + Intronic
1050227134 9:3472209-3472231 GGCCAAGAATATTAAAGCACCGG + Intronic
1050227519 9:3476796-3476818 GGCCAAGAATATTAAAGCACCGG + Intronic
1052301907 9:26961462-26961484 GTCCCACAATTTTAAAGAAAAGG - Intronic
1058092084 9:100815859-100815881 GGCTCACAATGTCAAACAAGGGG + Intergenic
1061855517 9:133440021-133440043 GGCCCTCAATAGCAAAGAAGCGG - Intronic
1186434926 X:9534458-9534480 AGTCCACAATAGCTAAGAACAGG - Intronic
1192626843 X:72737670-72737692 GGACCACAATATCAAGGAAGTGG - Intergenic
1192655431 X:72988464-72988486 GGACCACAATATCAAGGAAGTGG + Intergenic
1193205633 X:78744604-78744626 TGCCAACAATATCAAAGGACTGG - Intergenic
1196010831 X:110886440-110886462 GGCCCACTATATAAAACAGCTGG - Intergenic
1198055234 X:132987605-132987627 AGCCTACAAAGTCAAAGAACTGG + Intergenic
1200014068 X:153145935-153145957 GCCTCACAATATATAAGAACTGG + Intergenic