ID: 1114701740

View in Genome Browser
Species Human (GRCh38)
Location 14:24685643-24685665
Sequence ACCAGGACGTTGCAGGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114701740_1114701746 -5 Left 1114701740 14:24685643-24685665 CCCAAACCCTGCAACGTCCTGGT No data
Right 1114701746 14:24685661-24685683 CTGGTTCCTACACAGACACTGGG No data
1114701740_1114701749 27 Left 1114701740 14:24685643-24685665 CCCAAACCCTGCAACGTCCTGGT No data
Right 1114701749 14:24685693-24685715 TACATGGTCAAGTCAATAGTAGG No data
1114701740_1114701748 11 Left 1114701740 14:24685643-24685665 CCCAAACCCTGCAACGTCCTGGT No data
Right 1114701748 14:24685677-24685699 CACTGGGTTTCTATTCTACATGG No data
1114701740_1114701745 -6 Left 1114701740 14:24685643-24685665 CCCAAACCCTGCAACGTCCTGGT No data
Right 1114701745 14:24685660-24685682 CCTGGTTCCTACACAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114701740 Original CRISPR ACCAGGACGTTGCAGGGTTT GGG (reversed) Intergenic
No off target data available for this crispr