ID: 1114702078

View in Genome Browser
Species Human (GRCh38)
Location 14:24688867-24688889
Sequence CAGGAGGCCCTCAATAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114702071_1114702078 1 Left 1114702071 14:24688843-24688865 CCAGGTCTTTAGAGCACTGCAAC No data
Right 1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG No data
1114702070_1114702078 17 Left 1114702070 14:24688827-24688849 CCACATTCTCACAATACCAGGTC No data
Right 1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114702078 Original CRISPR CAGGAGGCCCTCAATAAGGA GGG Intergenic
No off target data available for this crispr