ID: 1114705387

View in Genome Browser
Species Human (GRCh38)
Location 14:24721217-24721239
Sequence TACTCATATGTGCCTCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114705387_1114705389 23 Left 1114705387 14:24721217-24721239 CCAAAGTGAGGCACATATGAGTA No data
Right 1114705389 14:24721263-24721285 GAGAACTATACCTATTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114705387 Original CRISPR TACTCATATGTGCCTCACTT TGG (reversed) Intergenic
No off target data available for this crispr