ID: 1114709648

View in Genome Browser
Species Human (GRCh38)
Location 14:24765617-24765639
Sequence AAGCCCATGCTGTCTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114709648_1114709651 0 Left 1114709648 14:24765617-24765639 CCACAAAGAGACAGCATGGGCTT No data
Right 1114709651 14:24765640-24765662 GGAGGCAGATCACTGAGTATAGG No data
1114709648_1114709653 15 Left 1114709648 14:24765617-24765639 CCACAAAGAGACAGCATGGGCTT No data
Right 1114709653 14:24765655-24765677 AGTATAGGATTTAAGGATTCAGG No data
1114709648_1114709652 8 Left 1114709648 14:24765617-24765639 CCACAAAGAGACAGCATGGGCTT No data
Right 1114709652 14:24765648-24765670 ATCACTGAGTATAGGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114709648 Original CRISPR AAGCCCATGCTGTCTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr