ID: 1114709820

View in Genome Browser
Species Human (GRCh38)
Location 14:24766957-24766979
Sequence CCCTTGTCTGCCATCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114709818_1114709820 3 Left 1114709818 14:24766931-24766953 CCTCTGCGTTTGAAGGCAGCTCT No data
Right 1114709820 14:24766957-24766979 CCCTTGTCTGCCATCTTCAGTGG No data
1114709816_1114709820 18 Left 1114709816 14:24766916-24766938 CCAAAGGAGTTTGGGCCTCTGCG No data
Right 1114709820 14:24766957-24766979 CCCTTGTCTGCCATCTTCAGTGG No data
1114709814_1114709820 20 Left 1114709814 14:24766914-24766936 CCCCAAAGGAGTTTGGGCCTCTG No data
Right 1114709820 14:24766957-24766979 CCCTTGTCTGCCATCTTCAGTGG No data
1114709815_1114709820 19 Left 1114709815 14:24766915-24766937 CCCAAAGGAGTTTGGGCCTCTGC No data
Right 1114709820 14:24766957-24766979 CCCTTGTCTGCCATCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114709820 Original CRISPR CCCTTGTCTGCCATCTTCAG TGG Intergenic
No off target data available for this crispr