ID: 1114713785

View in Genome Browser
Species Human (GRCh38)
Location 14:24804174-24804196
Sequence CTGTGGAAACAGCAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114713785_1114713793 -2 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713793 14:24804195-24804217 AGGGAAAGTGAGGCCAGGCTGGG No data
1114713785_1114713792 -3 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713792 14:24804194-24804216 CAGGGAAAGTGAGGCCAGGCTGG No data
1114713785_1114713794 10 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data
1114713785_1114713796 11 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713796 14:24804208-24804230 CCAGGCTGGGCAACCCCACAGGG No data
1114713785_1114713799 25 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data
1114713785_1114713790 -7 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713790 14:24804190-24804212 TCCACAGGGAAAGTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114713785 Original CRISPR CTGTGGAAACAGCAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr