ID: 1114713792

View in Genome Browser
Species Human (GRCh38)
Location 14:24804194-24804216
Sequence CAGGGAAAGTGAGGCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114713782_1114713792 9 Left 1114713782 14:24804162-24804184 CCTTCTTCCCGTCCTTCCTTCTG No data
Right 1114713792 14:24804194-24804216 CAGGGAAAGTGAGGCCAGGCTGG No data
1114713784_1114713792 1 Left 1114713784 14:24804170-24804192 CCGTCCTTCCTTCTGCTGTTTCC No data
Right 1114713792 14:24804194-24804216 CAGGGAAAGTGAGGCCAGGCTGG No data
1114713788_1114713792 -7 Left 1114713788 14:24804178-24804200 CCTTCTGCTGTTTCCACAGGGAA No data
Right 1114713792 14:24804194-24804216 CAGGGAAAGTGAGGCCAGGCTGG No data
1114713783_1114713792 2 Left 1114713783 14:24804169-24804191 CCCGTCCTTCCTTCTGCTGTTTC No data
Right 1114713792 14:24804194-24804216 CAGGGAAAGTGAGGCCAGGCTGG No data
1114713785_1114713792 -3 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713792 14:24804194-24804216 CAGGGAAAGTGAGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114713792 Original CRISPR CAGGGAAAGTGAGGCCAGGC TGG Intergenic
No off target data available for this crispr