ID: 1114713794

View in Genome Browser
Species Human (GRCh38)
Location 14:24804207-24804229
Sequence GCCAGGCTGGGCAACCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114713788_1114713794 6 Left 1114713788 14:24804178-24804200 CCTTCTGCTGTTTCCACAGGGAA No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data
1114713783_1114713794 15 Left 1114713783 14:24804169-24804191 CCCGTCCTTCCTTCTGCTGTTTC No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data
1114713782_1114713794 22 Left 1114713782 14:24804162-24804184 CCTTCTTCCCGTCCTTCCTTCTG No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data
1114713784_1114713794 14 Left 1114713784 14:24804170-24804192 CCGTCCTTCCTTCTGCTGTTTCC No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data
1114713785_1114713794 10 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data
1114713791_1114713794 -7 Left 1114713791 14:24804191-24804213 CCACAGGGAAAGTGAGGCCAGGC No data
Right 1114713794 14:24804207-24804229 GCCAGGCTGGGCAACCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114713794 Original CRISPR GCCAGGCTGGGCAACCCCAC AGG Intergenic
No off target data available for this crispr