ID: 1114713799

View in Genome Browser
Species Human (GRCh38)
Location 14:24804222-24804244
Sequence CCCACAGGGCAGCAGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114713785_1114713799 25 Left 1114713785 14:24804174-24804196 CCTTCCTTCTGCTGTTTCCACAG No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data
1114713783_1114713799 30 Left 1114713783 14:24804169-24804191 CCCGTCCTTCCTTCTGCTGTTTC No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data
1114713791_1114713799 8 Left 1114713791 14:24804191-24804213 CCACAGGGAAAGTGAGGCCAGGC No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data
1114713784_1114713799 29 Left 1114713784 14:24804170-24804192 CCGTCCTTCCTTCTGCTGTTTCC No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data
1114713795_1114713799 -9 Left 1114713795 14:24804208-24804230 CCAGGCTGGGCAACCCCACAGGG No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data
1114713788_1114713799 21 Left 1114713788 14:24804178-24804200 CCTTCTGCTGTTTCCACAGGGAA No data
Right 1114713799 14:24804222-24804244 CCCACAGGGCAGCAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114713799 Original CRISPR CCCACAGGGCAGCAGAGAGC TGG Intergenic
No off target data available for this crispr