ID: 1114714280

View in Genome Browser
Species Human (GRCh38)
Location 14:24807974-24807996
Sequence TAGAAAACACAACATGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114714276_1114714280 16 Left 1114714276 14:24807935-24807957 CCGGTCATCCCAGACCTGCTGGA No data
Right 1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG No data
1114714277_1114714280 8 Left 1114714277 14:24807943-24807965 CCCAGACCTGCTGGAATTTTTTT No data
Right 1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG No data
1114714274_1114714280 17 Left 1114714274 14:24807934-24807956 CCCGGTCATCCCAGACCTGCTGG No data
Right 1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG No data
1114714273_1114714280 24 Left 1114714273 14:24807927-24807949 CCAGGTGCCCGGTCATCCCAGAC No data
Right 1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG No data
1114714279_1114714280 2 Left 1114714279 14:24807949-24807971 CCTGCTGGAATTTTTTTTTTTTC No data
Right 1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG No data
1114714278_1114714280 7 Left 1114714278 14:24807944-24807966 CCAGACCTGCTGGAATTTTTTTT No data
Right 1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114714280 Original CRISPR TAGAAAACACAACATGACCA AGG Intergenic
No off target data available for this crispr